role of the gastric ecosystem in helicobacter associated gastritis
Transkript
role of the gastric ecosystem in helicobacter associated gastritis
ROLE OF THE GASTRIC ECOSYSTEM IN HELICOBACTER ASSOCIATED GASTRITIS by JULIA M. SCHMITZ ROBIN G. LORENZ, COMMITTEE CHAIR LOUIS B. JUSTEMENT SUZANNE M. MICHALEK PHILLIP D. SMITH CASEY T. WEAVER A DISSERTATION Submitted to the graduate faculty of The University of Alabama at Birmingham, in partial fulfillment of the requirements for the degree of Doctor of Philosophy BIRMINGHAM, ALABAMA 2008 ROLE OF THE GASTRIC ECOSYSTEM IN HELICOBACTER ASSOCIATED GASTRITIS JULIA M. SCHMITZ MICROBIOLOGY ABSTRACT The second leading cause of cancer death, gastric cancer, is associated with infection by Helicobacter pylori but the mechanism for the disease is still unknown. Since infection with H. pylori does not always result in gastric adenocarcinoma in the mouse; we infect with H. felis which results in gastric adenocarcinoma within twelve to fifteen months of infection. We hypothesize that Helicobacter-associated gastric adenocarcinoma is secondary to alterations induced in the protective mucus lining by the immune response to Helicobacter. Chemokines play a role in the movement and localization of inflammatory cells in disease. CXCL15, a member of the ELR+ CXC chemokine family known for neutrophil recruitment, was only expressed strongly in lung. Due to the common mucosal system of the stomach and the lung, CXCL15 expression was analyzed in the murine gastrointestinal tract. Strong expression is now reported in the gastrointestinal, urogenital, and endocrine system. Due to neutrophil infiltrates in H. felis infection, expression of CXCL15 was analyzed in our gastritis model and was highly increased after eight weeks. Alterations are seen in the mucin and trefoil factor family in the human model, but no comprehensive study has been done in the mouse model of H. felis infection. Analysis of the mucin changes showed that muc5ac was lost in the mouse model, which mimics the human disease. An increase in the expression of muc4 and muc5b is evident in the disease, indicating a loss of muc5ac with a gain of muc4 and ii muc5b correlating with disease progression. The stomach, which was originally thought to be a sterile environment, has been shown to contain numerous pathogens. The role of other microbial components, besides Helicobacter, has not been studied in this disease model. Through analysis of H. felis infection in a gnotobiotic (B6.GB) model and a defined flora model (B6.ASF), it was shown that the B6.GB and B6.ASF animals had similar histology but did not clear the bacteria. This along with an altered expression in Th17 and Tregs has led to the knowledge that there are several mechanisms for the gastric histology. iii ACKNOWLEDGMENTS Thank you to my parents, Mike and Winnie, for the guidance and support given to me through the years. None of this would have been possible without it. You have inspired me to always better myself, and I owe my successes life to all the sacrifices you have made for me. Thank you, Robin, for all your patience, wisdom, guidance, and support throughout this journey. You kept telling me I could do it, even when I was not sure I could. You were a wonderful mentor to me and I could not have asked for a better experience. You have helped me grow into a confident scientist as well as a stronger person. I am proud to say I was a member of the Lorenz lab. I like to thank St. Peter‟s Folk Choir – you have become my family away from home. You have given me the encouragement, support, and love that I needed to make it through this. I was truly blessed to have been a part of a great group of people and I will certainly miss you. Thanks also to Jonah, the choir kid, for making me laugh when things were tough. Dalia and Djamila, thank you for being my friends and for the support you offered to me while I was here. I am sure where ever life leads us, we will always make time for each other and I will forever be grateful for that. To Katy, Laurel, and Jenny, thank you for your continued support and friendship throughout this time. Who knew when we met on the first day at Sweet Briar that our friendship would still be going strong no matter iv how far apart we are from each other. I am truly blessed to have met you and can not wait to see where the future will lead us. Finally to the Lorenz lab, you have offered me the support and friendships needed to make it through this journey. Thank you to everyone who helped with my project throughout the years – I could not have done this without you. I wish everyone luck in their future endeavors. v TABLE OF CONTENTS Page ABSTRACT ........................................................................................................................ ii ACKNOWLEDGEMENTS ............................................................................................... iv LIST OF TABLES ............................................................................................................ vii LIST OF FIGURES ......................................................................................................... viii INTRODUCTION ...............................................................................................................1 Helicobacter felis .....................................................................................................2 Mucins and Trefoil Factors ......................................................................................5 Immune Response ....................................................................................................9 Mouse Models ........................................................................................................12 Aims of Dissertation ..............................................................................................15 EXPRESSION OF CXCL15 (LUNGKINE) IN MURINE GASTROINTESTINAL, UROGENITAL, AND ENDOCRINE ORGANS ...........................................................................................................................16 ROLE OF ADAPTIVE IMMUNITY IN MUCUS ALTERATIONS ASSOCIATED WITH GASTRIC HELIOCBACTER INFECTION ...............................51 HELICOBATER FELIS ASSOCIATED GASTRIC PATHOLOGY IN GNOTOBIOTIC MICE .....................................................................................................85 CONCLUSIONS..............................................................................................................124 GENERAL LIST OF REFERENCES .............................................................................131 APPENDIX: ANIMAL USE APPROVAL FORM .........................................................139 vi LIST OF TABLES Table Page ROLE OF ADAPTIVE IMMUNITY IN MUCUS ALTERATIONS ASSOCIATED WITH GASTRIC HELIOCBACTER INFECTION 1 Primer-Probe pairs utilized for qRT-PCR...................................................................60 2 Average Fold Change and +/- Range of Mucin Genes ...............................................68 3 Comparison of Human and Murine Mucin Changes ..................................................78 HELICOBATER FELIS ASSOCIATED GASTRIC PATHOLOGY IN GNOTOBIOTIC MICE 1 Primer-Probe pairs utilized for qRT-PCR...................................................................95 2 Average Fold Change and +/- Range of Epithelial Genes ........................................112 3 Average Fold Change and +/- Range of Immune Response .....................................113 vii LIST OF FIGURES Figure Page INTRODUCTION 1 Diagram of histological changes in C57BL/6 mouse infected with H. felis .................3 2 Histological and colonization scores over the course of infection in C57BL/6 mice ...............................................................................................................4 3 Muc5ac staining the stomach .......................................................................................8 4 Denaturing Gradient Gel Electrophoresis of DNA isolated from mock and Helicobacter infected stomachs of B6 mice ...............................................14 EXPRESSION OF CXCL15 (LUNGKINE) IN MURINE GASTROINTESTINAL, UROGENITAL, AND ENDOCRINE ORGANS 1 Expression of CXCL15 in multiple murine tissues ....................................................28 2 Immunofluorescence analysis of CXCL15 protein expression ..................................29 3 CXCL15 expression in gastric prezymogenic cells ....................................................32 4 Histology and CXCL15 expression in gastric (A, B) and colonic (C-F) models of inflammation ..............................................................................................36 5 The expression of ELR+ CXC chemokines in select tissues of the gastrointestinal tract ....................................................................................................38 S1 Expression of CXCL15 (green) was evaluated by immunofluorescence in the three inflamed models of inflammation ...........................................................49 S2 Immunofluorescent analysis of neutrophils in the gastritis and colitis Models........................................................................................................................50 ROLE OF ADAPTIVE IMMUNITY IN MUCUS ALTERATIONS ASSOCIATED WITH GASTRIC HELIOCBACTER INFECTION 1 Disease progression during H. felis infection in C57BL/6 mice ................................66 2 RNA expression of mucins over the course of infection ............................................69 viii LIST OF FIGURES (continued) Figure Page 3 Immunofluorescent analysis of mucins over the course of infection .........................71 4 Immunofluorescent expression of Muc5ac over the course of the infection ..............73 5 Comparison of mucin expression in C56BL/6 and B6.RAG-1-/infected mice ................................................................................................................74 HELICOBATER FELIS ASSOCIATED GASTRIC PATHOLOGY IN GNOTOBIOTIC MICE 1 Disease progression in B6.SPF, B6.GB, and B6.ASF stomachs after H. felis infection. ..............................................................................................104 2 DGGE on gastric washes from B6.SPF and B6.ASF infected animals ....................107 3 Muc5ac expression after H. felis infection ...............................................................109 4 Total and H. felis-specific antibody responses after H. felis infection .....................110 5 Immune response after H. felis infection in three different animal models .............114 CONCLUSIONS 1 Diagram of the histological changes in the progression to gastric adenocarcinoma .............................................................................................130 ix INTRODUCTION Gastric cancer is the second leading cause of cancer death worldwide (1-3). There are two primary types of gastric cancer – diffuse type and intestinal type. Diffuse type gastric cancer is more common among younger persons and invades the tissues of the stomach without forming any glands or ulceration. Intestinal type gastric cancer is more common among the elderly, especially men, and is believed to be a result of a stepwise progression from normal gastric epithelium to dysplastic epithelium and finally metaplastic epithelium (1, 2, 4). In the 1980s, Barry Marshall and Robin Warren discovered a gram-negative bacteria, Helicobacter pylori, showing it caused gastritis. It was later shown to cause gastric distress such as gastric cancer and ulcers (1, 3, 5). Although it is known that H. pylori causes gastric cancer, the mechanism by which it does this is still not known (3). H. pylori is usually acquired during childhood and persists throughout a lifetime unless eradicated with antibiotics (6). During this persistence in the human stomach, the host begins to mount an immune response against the bacteria but never clears the infection. It is thought that this immune response contributes to the severity of the disease (7). The bacterium is transmitted from person to person with infection occurring via fecal-oral or gastro-oral route (3). H. pylori has been shown to be species-specific in that it only colonizes in humans and nonhuman primates. It is also usually found to be swimming in the mucus layer of the gastric tissue (6). H. 1 pylori uses its flagella to colonize the mucus layer of the stomach and is thus protected by the mucus from the acidic environment of the stomach, unlike most other bacteria. Helicobacter felis As it is difficult to pursue human studies because of the genetic variability between humans and it is unclear of the exact moment that humans become colonized with Helicobacter, other models are used to study the disease process of gastric cancer. In our lab we currently use a H. felis infected mouse model on the C57BL/6 (B6) background, which closely resembles the human disease in that both human and mice go through the same histological changes: chronic gastritis, atrophy, metaplasia, dysplasia, and adenocarcinoma (8, 9). The first histological change, chronic gastritis is persistent inflammation in the stomach. It is recognized by the inflammatory infiltrates evident between the stomach glands. This is followed by atrophy where there is a lost specialized glandular tissue, such as the parietal cells. The stomach will then move into a metaplasia stage where the stomach actually begins to resemble the intestine, with inflammatory infiltrates. The next stage of changes is called dysplasia, which is represented by abnormal growth or development of cells. Finally, the stomach histologically progresses to adenocarcinoma which is described as an invasion of infiltrates through the muscularis layer (10). Figure 1 shows the diagram of the histological changes in our C57BL/6 mouse model that has been infected with H. felis. Interestingly as shown in Figure 2 the histological score of the C57BL/6 mice increase over the course of infection, the colonization score for H. felis decreases showing that they are inversely proportional to each other as is evident in the human model (11, 12). A mouse adapted H. pylori infected 2 Normal Colonization of H. felis Chronic gastritis Atrophy Metaplasia Disappearance of H. felis Adenocarcinoma Figure 1: Diagram of histological changes in C57BL/6 mouse infected with H. felis. These changes mimic what is seen in the human disease. The change from normal stomach to chronic gastritis is marked by inflammation in the stomach as well as the appearance of H. felis. The next stage, atrophy, is marked by the lost of the parietal cells which causes an increase in the pH of the stomach. The stomach then moves into a metaplasia stage where the stomach resembles an intestine. Finally the stomach changes from metaplasia to gastric adenocarcinoma where there is a clearance of H. felis in the mouse model. 3 3 2 1 HF Colonization Score Histological Score 4 9 8 7 6 5 4 3 2 1 0 0 4 weeks 8 weeks 12 weeks 16 weeks 20 weeks Weeks infected 24 weeks 52 weeks Histology Score H. felis Colonization Figure 2: Histological and colonization scores over the course of infection in C57BL/6 mice. The histological scores are on a 0 – 9 scale (0 = no inflammation; 9 = severe) with scores of 0 – 3 on the histology of each of the following three areas: longitudinal extent of inflammation, vertical extent of inflammation, and histological changes. The colonization scores are on a 0 – 4 scale (0 = no bacteria present; 4 = more than 20 bacteria per gland). 4 C57BL/6 mouse has been studied by other labs, but these mice do not consistently develop dysplasia and carcinoma (13). In our lab 58% of C57BL/6 mice infected with H. felis for twelve months will develop gastric adenocarcinoma (unpublished data). Another lab has infected the mice for fifteen months and shown a 100% development of gastric adenocarcinoma (8). In the stomach there are four major differentiated epithelial cell types. The parietal cells, found mostly in the zymogenic zone and mucoparietal zone (two continuous zones located at the squamocolumnar junction), possess H+/K+ -ATPase pumps which are responsible for the production of the acidic environment in the lumen. The zymogenic (chief) cells, found in the zymogenic zone, secrete proteins such as intrinsic factor and pepsinogen, which are needed for digestion and absorption of proteins and vitamins. The last two cell types – surface mucus cells and mucus neck cells – produce the mucus layer and act to protect the surface of the stomach from the acidic environment (14). Previous studies have shown that patients in the early stages of the infection process – chronic gastritis and atrophy – have higher gastric mucosal cell proliferation and decreased cell numbers of differentiated gastric epithelial cells such as parietal cells and zymogenic cells (15, 16). With the loss of parietal cells during the infection, the pH in the stomach increases which could allow other bacteria to be able to colonize in the stomach. Mucins and Trefoil Factors Mucus, a gel-like substance that covers the mammalian epithelial surfaces of tissues, is composed of mucins and trefoil factors (TFF) (17, 18). Mucus acts as both a 5 lubricant and also as a protective barrier between the contents of the stomach and the mucosal surface (19). In humans, twenty-one mucins have been identified in tissues such as lung, nose, salivary glands, and gastrointestinal tract (17, 20). Seven mucins have been identified in mice (Muc1, 2, 3, 4, 5ac, 5b, and 6) which are homologous to the human mucins. Mucins consist of a protein backbone with many carbohydrate side chains as well as tandem repeats of serine, theroine, and proline. There are two types of mucins – membrane bound (Muc1, 3, and 4) and secreted glycoproteins (Muc2, 5ac, 5b, and 6) (21, 22). The secreted mucins are conserved between the human and mouse forms (23). In humans, it has been shown that MUC1, MUC5AC, and MUC6 are expressed normally in the stomach. MUC2, MUC3, MUC4, and MUC5B are not normally expressed in the human stomach (24-26). Thus far, there have only been mice genetically engineered to be deficient of Muc1 or Muc2. The Muc1 null mice have been shown to have retarded development of T-antigen induced primary breast tumors (27). MUC1 was originally identified to play a role in colorectal cancer, although current studies shows it plays a role in the formation and progression of gastric tumors (28). Studies with Muc2 null mice showed that Muc2 plays a role in the suppression of colorectal cancer, as they developed tumors in the small intestine that progressed to invasive adenocarcinoma and rectal tumors (29). In humans and mice there are three trefoil factors (TFF): TFF1/pS2, TFF2/spasmolytic polypeptide (SP), and TFF3/intestinal trefoil factor (ITF). Trefoil factors are small, soluble peptides with trefoil or P domain (9). Trefoil peptides are secreted from the mucus granules of the mucus secreting cells (6). Trefoil peptides act as scaffolding for the mucins within the stomach with specific TFFs cross linking with 6 mucins to help form the gel layer in the stomach (6, 19). Previous studies in humans showed that TFF1 interacts with MUC5AC, TFF2 interacts with MUC6, and TFF3 interacts with MUC2 (6, 30). When there is a mucosal injury the trefoils are up-regulated and begin to stimulate repair in the tissue through epithelial restitution (19). Mice who are deficient in one of each of the three TFFs have been created (9). The TFF1 deficient mouse is predisposed to developing gastric cancer after five months (31). The TFF2 deficient mouse shows decreased gastric mucosal proliferations, increased parietal cells, and increased degree of gastric ulceration after administration of indomethacin (32). The TFF3 deficient mouse shows sensitivity to colonic injury by standard agents, such as dextran sulphate sodium, due to the inability to repair the epithelium (33). Changes have been seen in the mucins and TFFs expressed with Helicobacter infection. In human gastric cancer, MUC2, MUC3, MUC4, MUC5B, and TFF3 are not expressed in the normal stomach, but are expressed in a gastric cancer stomach. MUC5AC and TFF1 are the opposite as each is expressed in a normal stomach but not a stomach affected with gastric cancer. TFF2 expression is found to be expressed early in the cancer but is then lost in a stomach at the intestinal metaplasia stage (25, 34-37). One section of this dissertation aims to characterize the mucins changes in our mouse model and see how closely they mimic the human changes. In C57BL/6 mice infected with H. felis we also see the loss of Muc5ac in the squamocolumnar junction of the parietal zone of the stomach. This mimics what is seen in the human infection (see Figure 3). We hypothesize that these changes in the mucus layer are secondary to inflammatory mediators induced by gastric Helicobacter infection. Kurt-Jones et al. have shown that TFF2-/- infected with H. felis have an increased 7 A B Figure 3: Muc5ac staining the stomach. 3A shows muc5ac staining in the B6 mockinfected animal in the gastric body. The score for this section was a 2 out of a score on a 0 – 3 scale (0 = no staining, 1 = is sporadic staining, 2 = medium staining, 3 = bright staining). 3B shows muc5ac staining in the body of a H. felis infected B6 animal for 16 weeks. This section had a score of a 0. Only stomachs that had a score of 2 or 3 in the antrum section were evaluated for the lost of muc5ac over time. Bar = 50 microns. 8 susceptibility to gastritis (38). When infected with H. pylori the TFF2-/-mice showed increased levels of IFN (10). Immune Response Cytokines are proteins that cause surrounding immune system cells to become activated, except for regulatory cytokines which have been shown to inhibit Th1 responses (39). Previous data from other laboratories has shown that the Th1, Th17, and Treg responses are altered after infection with H. felis (40-42). Th17 effector T cells, named this because of the production of IL-17, are a recent finding, and its relationship with the other effector T cell populations, such as Th1 and Tregs are still being understood. The development of the Th17 cells is inhibited by IFN, but committed Th17 cells are resistant to suppression by cytokines produced by Th1 and Th2 (43). The Th17 cells have also been shown to produce TNF, IL-6, and IL-22 (44-47). As Th17 cells have been shown to play a role in the development of chronic inflammation in other inflammatory models, it is thought that they also play a role in H. felis mediated inflammation (41, 42). IL-17 is a pro-inflammatory cytokine that is made up of six family members: IL-17A, IL-17B, IL-17C, IL-17D, IL-17E (which is also known as IL-25), and IL-17F. IL-17A uses IL-17 receptor for signaling. Due to the close homology between IL-17A and F it is thought that IL-17F may signal through this receptor as well (44, 48). IL-17 has also been shown to be produced by activated memory T lymphocytes through regulation by IL-23 and IL-6 (49). Its function appears to be regulation of granulopoiesis and recruitment of neutrophils to sites of inflammation as it induces the release of CXC (cysteine-x-cysteine residue) chemokines and TNF in the lung (44, 48, 50). IL-17R 9 knockout mice have enhanced lethality, defective neutrophil recruitment, and defective granulopoiesis to experimental gram-negative Pneumonia (48). Small cytokines called chemokines play an important role in the movement and localization of inflammatory cells in disease (51). IL-17 has been shown to induce the release of CXC chemokines (50). CXCL15, also known as lungkine or WECHE, is a member of the ELR+ CXC (ELR is a glutamic acid-leucine-arginine motif immediately proceeding the CXC sequence) chemokine family (52). It has been previously reported to be strongly expressed only in the murine lung and weakly in the fetal heart and fetal lung (53). Previous data has shown that in a murine intestinal injury after ischemia-reperfusion there was no change in CXCL15 serum levels, while there was change in KC and MIP2, two other members of the ELR+ chemokines (54). It is reported that CXCL15, in both normal and inflammatory conditions, plays a role in recruitment of neutrophils. Through the use of a CXCL15 deficient animal, CXCL15 has been shown to play a role in the migration of the neutrophils from the lung parenchyma into the airspace (52). Mucins make up a large part of the lung and the stomach, which are both considered to be part of a common mucosal system. It is thought that CXCL15 may play a role in neutrophil recruitment in H. felis infection model (55, 56). Studies in the lung have shown that there are several cytokines that change the expression of Muc5ac such as IL-17 via IL-6 paracrine/autocrine loop and TNF (49, 57). An inhibitory cytokine, IL-10 is thought to underlie Treg function in vivo (58). Current studies suggest that Tregs may be involved in suppressing the immune response in H. pylori infection (40). IL-10 decreases T cell mediated immunity and initiates a humoral response (59). IL-10 deficient mice develop a chronic enterocolitis and if 10 stimulated with enteric antigens show an exaggerated immune response in some tissues (60). IL-10-/- have been shown to have severe gastritis as early as 6 weeks of infection and eradication of H. pylori early than their wild type counterparts. Thus, IL-10 producing Tregs might play a role in modulating the host response to gastrointestinal bacteria (61). Schroder et al found that IL-10 is a negative regulator of IFN (62). IFN- was originally known as a macrophage activating factor, due to the fact that stimulation of macrophages with IFN induces antimicrobial and antitumor mechanisms (62). IL-12 and IL-18 secretion by antigen presenting cells have been linked to the production of IFN, resulting in a connection between infection and IFN in innate immune response (62, 63). In humans, H. pylori causes a strong neutrophil recruitment, as well as increased IFN response from T cells (64). Other studies have demonstrated that T cell clones have high levels of production of IFN and TNF (7). IFN-/- mice infected with H. pylori did not result in gastric inflammation, illustrating a role of IFN- in the induced mucosal inflammation of H. pylori infection (65). Individuals with IL-1 polymophisms have been determined by DNA-protein interactions to have an increased risk for gastric cancer (66). IL-1 is an important pro-inflammatory cytokine and has been identified to be an inhibitor of gastric acid secretion (67, 68). Early in the infection with H. pylori it has been shown that IL-1, IL-6, and TNF are the proinflammatory cytokines produced (69). With the above mentioned cytokines and chemokines being increased with infection, it is hypothesized that they are key to the changes observed in the mucins at later time points. 11 Mouse models Different animal models have been infected in our lab. B6.RAG-1-/(recombination activating gene) infected with H. felis resulted in high levels of colonization but no histological changes (70). These mice are B and T cell deficient (71). Infection of B6.129S2-Igh-6tm1Cgn (B6.MT) results in severe gastric pathology as seen in the B6 model although it doesn‟t result in gastric adenocarcinoma after one year of infection (70). B6.mT mice are B cell deficient (72). These results prove that T lymphocytes are important in creating the gastric pathology seen in the H. felis infection (70). An adoptive transfer model has been used in our lab where lymphocytes are obtained from C57BL/6 mice and donated into B6.RAG-1-/- mice that have already been infected with H.felis for two weeks. The B6.RAG-1-/- mice are sacrificed six weeks after the lymphocyte transfer, resulting in severe gastritis, which is similar to what is seen in C57BL/6 mice infected for twelve weeks with H. felis (73). When the B-lymphocyte population was depleted, so only CD3+ were donated into the B6.RAG-1-/- mice, there was no difference in the histological scores from mice that had whole lymphocytes donated into them. This proves that T cells are sufficient for the gastric pathology. When the T lymphocytes were separated into CD4+ spleenocytes or CD8+ spleenocytes and donated in to the B6.RAG-1-/- separated, the CD4+ cells caused the same severe disease seen in the C57BL/6 mice. This proves that CD4+ cells are important for the gastric pathology seen (73). By using these different animal models more information can be gathered on the infection process by comparing the immune response and mucin changes in these animals. 12 During the progression to gastric cancer, the parietal cells are lost during the gastric atrophic stage (8, 10). The loss of parietal cells causes an increase in pH, which could then allow other bacteria that could not normally colonize in the stomach, because of the acidic environment, thrive in the stomach (74, 75). Previous unpublished data in our lab has shown that B6 mice infected with H. felis for eight weeks have bacterial bands not present in the mock animals by denaturing gradient gel electrophoresis (Figure 4). There are two valuable mouse models to analyze what happens with H. felis infection without these additional bacteria which allows us to begin to understand the role of other microbial components in the disease progression to gastric adenocarcinoma. Germ-free mice are absent of all types of bacteria and, thus, allow the researcher to study the effect of a specific bacteria or the interrelationship between two different bacteria in the system (76). By infecting these mice with H. felis, we can begin to understand if alterations in the gastric microbiota are important in gastric pathology. The gnotobiotic mice are critical to understanding the effects of a single bacterium on the environment; however, this does not mimic a normal environment. Another valuable type of mouse model is the defined flora mouse, otherwise known as Altered Schaedler Flora. The ASF mouse contains a cocktail of eight known various bacteria that were originally inoculated into a germ-free mouse, such as two Lactobacillus strains, a Bacteroides strain, a Clostridium cluster, a Flexistipes species, and a low G+C content gram positive bacteria (77-79). It has been shown that approximately 1.59 x 106 bacteria/gram of the ASF are present in the glandular stomach (78). By infecting the ASF mice with H. felis we can determine if any of the eight bacteria are sufficient to cause the gastric and mucin alterations seen in the B6 mouse model of infection. 13 Mock infected HF infected HF H. felis band Figure 4: Denaturing Gradient Gel Electrophoresis of DNA isolated from mock and Helicobacter infected stomachs of B6 mice. The first three lanes are B6 mock infected stomachs. The next three lanes are the B6 infected with H. felis for eight weeks stomachs. Notice the additional bands indicated by the circle that are not present in the mock infected stomachs. As a positive control DNA was isolated from a pure culture of H. felis. The band is indicated by the arrow and can only be seen in the Helicobacter infected animals. 14 Aims of Dissertation We hypothesize that Helicobacter-associated gastric adenocarcinoma is secondary to alterations induced in the protective mucus lining by the immune response to Helicobacter. The goals of this dissertation are: to analyze the expression of CXCL15 in the gastrointestinal tract, to document the immune and mucins changes over the course of infection in the mouse model as compared to the human disease, and to analyze the effects of H. felis on the system in a gnotobiotic model and a defined flora model. 15 EXPRESSION OF CXCL15 (LUNGKINE) IN MURINE GASTROINTESTINAL, UROGENITAL, AND ENDOCRINE ORGANS by JULIA M. SCHMITZ, VANCE J. McCRACKEN, REED A. DIMMITT, ROBIN G. LORENZ Journal of Histochemistry and Cytochemistry Volume 55(5): 515 – 524, 2007 Copyright 2007 by Journal of Histochemistry and Cytochemistry Used by permission Format adapted for dissertation 16 ABSTRACT The ELR+ chemokine CXCL15, which recruits neutrophils during pulmonary inflammation, is also known as lungkine due to its reported exclusive expression in the lung. We now report that CXCL15 mRNA and protein is also expressed in other mucosal and endocrine organs, including the gastrointestinal and urogenital tracts and the adrenal gland. Our results indicate that CXCL15 is expressed throughout the gastrointestinal tract, with the exception of the cecum. Gastric CXCL15 protein expression is approximately ten-fold lower than pulmonary expression, and primarily occurs in a specific lineage of gastric epithelial cells, the pre-zymogenic and zymogenic cell. Similar to the increased expression of CXCL15 during pulmonary inflammation, gastric inflammation induced by infection with Helicobacter felis caused an increase in gastric CXCL15 expression. However, colonic CXCL15 expression was not altered in two different models of colonic inflammation, the Helicobacter hepaticus T-cell transfer model and the mdr1a-/- model of colitis. These findings clearly demonstrate that CXCL15, previously reported to be the only lung-specific chemokine, is also highly expressed in other murine mucosal and endocrine organs. The functional role of CXCL15 in mucosal disease remains to be elucidated. 17 INTRODUCTION Chemokines are small cytokines that play an important role in the movement and localization of inflammatory cells in disease (1). Murine CXCL15, also known as lungkine or WECHE (WEird CHEmokine), was first described as a protein secreted into the airway spaces, which induced neutrophil migration (2, 3). Its protein structure contrasts with other CXC chemokines, as it contains an extended C-terminal domain of ~ 65aa. It also has the novel function of regulating hematopoietic differentiation into erythroid cells and acting as a chemoattractant for bone marrow progenitor cells (Ohneda et al. 2000). CXCL15 is part of the ELR+ CXC chemokine family, whose members contain a nonconserved amino acid between the first two cysteines (CXC), as well as a conserved ELR motif (glutamic acid-leucine-arginine) immediately preceding the CXC sequence (4, 5). Chemokines in the CXC family are involved in the recruitment of neutrophils, and can promote angiogenesis (5-7). Members of the human ELR+ CXC chemokine family include CXCL1 (GRO-), CXCL2 (GRO-), CXCL3 (GRO-), CXCL5 (ENA-78), CXCL6 (GCP-2), CXCL7 (NAP-2), and CXCL8 (IL-8). Mouse ELR+ CXC chemokines include keratinocyte-derived chemokine (KC), lipopolysaccharide-induced CXC chemokine (LIX), and macrophage inflammatory protein (MIP-2). Human ELR+ chemokines primarily bind to the receptor CXCR2, which promotes the chemotactic and angiogenic activity of these chemokines; however, CXCL6 and CXCL8 also bind CXCR1, which predominantly plays a role in neutrophil chemotaxis (5, 7). The mouse ELR+ chemokines (LIX, KC, MIP2) also primarily bind to CXCR2. In addition MIP-2 can bind to CXCR1 (6). The presence of CXCR1 receptor in 18 mice has been a controversial subject but recent findings suggest there is a human ortholog in the mouse (8). The receptor for murine CXCL15 has yet to be determined; however it appears not to bind human CXCR1 / CXCR2 or murine CXCR2 (2). There is no known human homologue of CXCL15. CXCL15 has been reported to be strongly expressed in the adult lung of the inbred mouse strains BALB/c and C57BL/6, but does not appear to be expressed in lymphoid organs such as the spleen (2, 3). CXCL15 is upregulated in response to multiple inflammatory stimuli, including an ovalbumin-induced model of asthma, and in Nippostrongylus brasiliensis or Aspergillus infection models (2). In these models, CXCL15 is believed to be released by bronchoepithelial cells into the airways, where it functions to increase the migration of neutrophils into the airway spaces (2). Additional support for a role of CXCL15 in pulmonary defense comes from studies using Klebsiella pneumoniae–infected mice deficient in CXCL15 (2, 4). Compared to infected wild-type controls, CXCL15-/- mice had an increased pulmonary bacterial load and decreased survival. In contrast to the role of CXCL15 in murine models of asthma and pulmonary infections, murine intestinal injury after ischemia-reperfusion resulted in no change in CXCL15 serum levels, although the expression of other ELR+ chemokines, KC and MIP2, was dramatically increased (9). Although the CXCL15 serum levels did not change, the baseline serum level of CXCL15 was ten times greater than the serum concentrations of KC and MIP-2. As pulmonary CXCL15 was believed to only be secreted into the airspaces, we decided to more fully investigate the possibility that secretion of CXCL15 could occur in other mucosal or endocrine organs. 19 MATERIALS AND METHODS Mice Five inbred mouse strains were used in this study; all mice were between 6 and 10 weeks old at the time of baseline analysis or initial infection, unless otherwise indicated. C57BL/6J, C57BL/6J-Rag-1tm1Mom (B6.Rag-1-/-), and BALB/cJ were obtained from The Jackson Labs, Bar Harbor, MA, and FVB/N mice and FVB.mdr1a-/- mice were obtained from Taconic, Hudson, NY. Mice were maintained on a 12:12-h light-dark schedule and fed standard laboratory mouse chow. Animal procedures and protocols were conducted in accordance with the Institution Animal Care and Use Committee at the University of Alabama at Birmingham (Birmingham, AL). Antibodies and Reagents Primary antibodies used in this study include: mouse anti-H+/K+ -ATPase (Clone 2G11; Sigma; St. Louis, MO), rabbit anti-intrinsic factor (IF; generous gift of David Alpers, Washington University Medical School, St. Louis, MO; 1:2000), rabbit antipepsinogen (generous gift of Michael Samloff, UCLA; Los Angeles, CA; 1:2000), and biotinylated goat anti-mouse CXCL15 which showed no cross reactivity with other chemokines and cytokines as tested by R&D Systems (R&D Systems DuoSet Part 840950; Minneapolis, MN; 0.5 g/mL). Fluorescently-labeled lectins used in this study were rhodamine Cholera toxin B (CTB; List Biological; Campbell, CA; 4 g/mL) and Texas Red Griffonia simplicifolia (TX R GSII; EY Laboratories, Inc.; San Mateo, CA; 1:200). Secondary and detection antibodies used included: Cy3 goat anti-mouse Fab 20 fragment (Jackson ImmunoResearch; West Grove, PA), biotin donkey anti-rabbit IgG (Jackson ImmunoResearch; 5.6 g/mL), streptavidin-HRP (Jackson ImmunoResearch; 1 g/mL), and FITC or Cy3-Tyramide diluted per manufacturer‟s instructions (PerkinElmer; Boston, MA; 1:100 and 1:1000 respectively). Nuclei were visualized by Hoechst dye (Sigma; St. Louis, MO; 2 g/mL). Tissue Preparation Immediately after sacrifice by isofluorane inhalation and cervical dislocation, tissues were removed for total RNA isolation and immunohistochemistry. All tissues removed were divided in half, with one half immersed in liquid nitrogen for total RNA isolation, while the other was submerged in Bouin‟s Fixative Liquid (Fisher Scientific; Pittsburgh, PA). The tissues were immersion fixed for 18-24 hours at 4oC, changed to 70% ethanol, placed in cassettes, and embedded in paraffin. Five-micron sections were prepared on a microtome and attached to pre-cleaned microscope slides (Snowcoat X-tra, Surgipath; Richmond, IL). Total RNA was isolated by the Trizol® method (Invitrogen; Carlsbad, CA), which uses phenol and guanidine isothiocyanate for total RNA extraction (10). Prior to cDNA synthesis, genomic DNA was removed from the extracted total RNA using the Turbo DNase kit (Ambion, Austin, TX). Using equivalent amounts of mRNA (2 g), cDNA was made utilizing reverse transcription with the Transcriptor First Strand cDNA Synthesis Kit (Roche, Pensberg, Germany). Quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) was performed using Applied Biosystems AssaysOn-Demand primer/probe sets and TaqMan Universal PCR Mix (PE Applied 21 Biosystems; Foster City, CA) combined with the Stratagene MX3000P real-time PCR machine. The following Applied Biosystems Assays-On-Demand primer/probe sets were used: 18S housekeeping gene (Hs99999901_s1; GeneBank ID#X03205), CXCL15 (Mm00441263_m1; GeneBank ID#NM 011339.1), CXCL1/KC (Mm00433859_m1; GeneBank ID#NM 008176), CXCL5/LIX (Mm00436451_g1; GeneBankID#NM 009141), and CXCL2/MIP2 (Mm00436450_m1; GeneBankID#NM 009140). Gene expression was calculated using the “delta-delta Ct” relative quantitation method as detailed by Applied Biosystems (Manufacturer‟s instructions; Applied Biosystems). Briefly, the relative expression (Ct) of each target gene is determined by comparing its crossing threshold (Ct) to the Ct for reference or housekeeping gene. For our studies, we chose 18S as the reference gene, as our pilot study (unpublished results), combined with other published results, indicates that several commonly utilized reference genes, such as GAPDH, HPRT, and -actin are altered during inflammatory states in the gastrointestinal tract (11). The Ct from each sample was then compared to an experimentally defined control to determine the Ct, which is used in the formula 2Ct to determine the fold change in mRNA expression (11, 12). To quantify the amount of CXCL15 protein in the various organs, protein was isolated from multiple C57BL/6 tissues. Briefly, the tissues were placed in a buffer of 500 mM NaCl/50 mM Hepes, pH 7.4 containing 0.1% Triton X-100, 0.02% NaN3 (Fisher Scientific, Pittsburgh, PA), and protease inhibitor cocktail for mammalian tissues (Sigma, St. Louis, MO; p8340). The tissues were then homogenized followed by an overnight freeze at -20oC. After thawing the tissue extracts were spun at 6000 x g for 20 minutes at 4oC (13). The supernatant protein concentration was determined by the Bio-Rad Protein 22 Concentration Assay following the DC Protein Assay Instruction Manual (catalog #5000116; Bio-Rad Laboratories, Hercules, CA). To determine the amount of CXCL15 expressed in each tissue, routine ELISAs were performed on triplicate samples according to the manufacturer‟s protocol (R&D Systems; Minneapolis, MN). The optical density of the samples was read on a VERSAmax® microplate reader (Molecular Devices, Sunnyvale, CA) and the data were analyzed with Soft Max Pro 4.7®. The limit of detection for this assay was 200 pg/mL. Immunofluorescence Staining Immunofluorescence staining for CXCL15 was performed on paraffin-embedded tissues. Briefly, the tissues were deparaffinized with Citrosolv (Fisher Scientific), and isopropanol, and rehydrated with phosphate buffered saline (PBS). The tissues then went through a 3% hydrogen peroxidase step for five minutes to block endogenous peroxidases, and an antigen retrieval step (0.1 M citric acid, 0.1 M Na citrate boiled for 17 minutes) to unmask epitopes. Next, the tissues were blocked with avidin and biotin (Vector catalog # SP-2001; Burlingame, CA) each for fifteen minutes. The last blocking step was a PBS-blocking buffer (which consists of 1% bovine serum albumin and 0.3% Triton) for fifteen minutes to block non-specifically binding proteins and to provide antibodies access to cell surface and internal antigens. After the above blocking steps, slides were incubated with biotinylated anti-mouse CXCL15 (R&D Systems) primary antibody (overnight at 4oC), followed by streptavidin-HRP, with detection by FITC Tyramide. 23 The mouse anti-H+/K+ -ATPase was detected using a “mouse on mouse” protocol with detection by Cy3 goat anti-mouse Fab Fragment (14). Briefly the slides are blocked with PBS-blocking buffer for an hour. During this hour the primary and secondary antibodies are incubated together at a 1:2 ratio for forty minutes at room temperature and then blocked with excess serum to block the unbound Fab fragments for ten minutes before being placed on the slide. Detection of the primary rabbit anti-IF and -pepsinogen was by a biotin donkey anti-rabbit IgG, followed by a streptavidin-HRP step, and finally a Cy3 Tyramide step. For the IF, pepsinogen, CTB, and TX R-GSII costaining experiments with CXCL15, the primary antibodies were added together and the CXCL15 staining was taken through to detection (FITC Tyramide) followed by an additional 3% hydrogen peroxidase step before detection of the other primary antibody. For the H+/K+ ATPase and CXCL15 costaining experiment, the CXCL15 staining protocol was taken through to detection, then the slides were blocked for the “mouse on mouse” protocol, and then the H+/K+ -ATPase/Cy3 FAB fragment complex was added. To determine the specificity of the CXCL15 immunostaining pattern, a preabsorption control was performed (15). Briefly, a two-fold excess (on a weight basis) of the recombinant mouse CXCL15 (100 l of 1 g/ml; R&D Systems; Minneapolis, MN) was preincubated with the biotin goat anti-CXCL15 (1 l of 50 g/ml) for one hour at 37oC. This preincubation mixture was then placed on the slide in place of the primary antibody and the rest of the steps were carried out as described above. For all staining protocols, a slide was done with no primary antibodies to confirm the staining seen was real. 24 Helicobacter felis Infections C57BL/6J mice were infected with H. felis or mock-infected as described previously (16). Briefly, mice were infected orally with 5 X 107 CFU H. felis (ATCC 49179) per inoculation in 25 l of brain-heart infusion broth (BHI)/glycerol three times over a one week period. This protocol results in 100% infection efficiency in our laboratory. The mock-infected mice were inoculated with freezing medium, a sterile BHI/glycerol mixture. Colitis Models Colitis was induced in Helicobacter hepaticus-infected B6.Rag-1-/- mice using a previously described model, with minor modifications (17). Adult B6.Rag-1-/- recipient mice, certified free from Helicobacter by the supplier, were infected orally three times over a seven-day period with 5 x 107 CFU H. hepaticus (ATCC 51488) resuspended in 25 l freezing medium. H. hepaticus was cultured on Brucella blood agar (Difco; Kansas City, MO) and inoculated into Brucella broth containing 5% fetal calf serum for infections as described previously (18). Lymphocytes were isolated from spleens and mesenteric lymph node of uninfected C57BL/6J mice by mechanical dissociation followed by lysis of erythrocytes and purification for CD4+ T cells using magnetic microbeads coated with rat anti-mouse CD4 (L3T4; Miltenyi Biotec, Auburn, CA). CD4+ T cells (4 x 105) from uninfected C57BL/6J mice were injected i.p. into two-week H. hepaticus infected or mock-infected B6.Rag-1-/- mice. The animals were followed for an additional six weeks by closely monitoring for weight loss and diarrhea. At sacrifice, the colons of recipient mice were excised, processed, and stained with hematoxylin and 25 eosin; portions of each tissue were also stored in LN2 for subsequent mRNA analysis as described above. The second model of colitis utilized in this study was the FVB.mdr1a-/- mouse (19). In the FVB.mdr1a-/- mouse model, the absence of intestinal P-glycoprotein leads to severe colonic inflammation (19). To assess the involvement of CXCL15 in this model of IBD, FVB.mdr1a-/- and FVB control mice were sacrificed at 5 months of age. Their colons were excised, processed, and stained with hematoxylin and eosin; portions of each tissue were also stored in LN2 for subsequent mRNA analysis as described above. Graphic and Statistical Analysis Graphs of the calculated mean fold change from the RT-PCR were created using GraphPad Prism 4® (GraphPad Software; San Diego, CA). All qRT-PCR graphs are organized horizontally and with the y-axis at one to represent the baseline expression of each gene for the comparison, except for Figure 1A, which is normalized to lung. Error bars represent the standard error between fold changes. Statistics were performed for all RT-PCR and ELISA experiments using Sigma Stat v. 2.03 ® and results were graphed with GraphPad Prism 4®. A student‟s t-test was performed to determine statistical significance which was defined as P < 0.05. 26 RESULTS CXCL15 Expression in Murine Mucosal and Endocrine Tissues We examined the level of CXCL15 mRNA expression in mucosal and endocrine organ systems of the C57BL/6J mouse. Figure 1 (top) shows the mRNA expression levels of CXCL15, graphed as a ratio against the expression seen in the lung. Although the highest expression of CXCL15 is found in the lung, there is significant expression in adrenal glands and in multiple mucosal organs, including the respiratory, gastrointestinal, and urogenital tracts. There was minimal to no expression of CXCL15 detected in the cecum, testes, or spleen (Figure 1 top and data not shown). The expression of CXCL15 by RT-PCR was tested on the same tissues from BALB/cJ and FVB/N mice and the expression level was similar to those shown for the C57BL/6J mice (data not shown). To validate the qRT-PCR expression, total protein was isolated from C57BL/6J tissues and CXCL15 protein expression was determined by ELISA. As was predicted by the mRNA analysis, the lung expressed high levels of CXCL15 protein; however surprisingly on a per mg basis, the adrenal gland actually expressed the highest level of CXCL15 protein (Figure 1, bottom). CXCL15 protein was not observed in the ileum and cecum. To determine the pattern of CXCL15 protein expression, several tissues were analyzed by immunofluorescent staining. As can be seen in Figures 2A-D, tissues expressing CXCL15 mRNA all demonstrated CXCL15 immunoreactivity as detected by a biotin-goat-anti-mouse CXCL15 antibody. This included the adrenal gland, trachea, colon, and uterus. In the adrenal gland, staining for CXCL15 was concentrated in the 27 Figure 1: Expression of CXCL15 in multiple murine tissues. Top: The mRNA expression of CXCL15 in mucosal and endocrine tissues of 12-week-old C57BL/6 mice. Expression is graphed as a ratio of lung CXCL15 expression. Expression was similar for FVB/N and BALB/c mice (data not shown). As previously reported, the lung has a high level of expression of CXCL15, but here we also demonstrate significant levels of expression in other mucosal and glandular organs, including trachea, stomach, jejunum, and adrenal gland. Bottom: CXCL15 protein expression was determined by ELISA. High protein expression is seen in the lung, adrenal gland, and other mucosal tissues (n = 3). *p < 0.05 as compared with lung. 28 Figure 2: Immunofluorescence analysis of CXCL15 protein expression. (A) Expression of CXCL15 (green) in the adrenal gland of a C57BL/6 mouse. Bright staining is seen in the pan-cortex, with increased intensity in the zona glomerulosa. All sections were counterstained with the nuclear dye, Hoechst 33258 (blue). (B) CXCL15 (green) immunoreactivity in the trachea of C57BL/6 mouse. (C) CXCL15 (green) can be seen in the colonic goblet cells as indicated by the arrow. (D) Expression of CXCL15 (green) in the uterus of a C57BL/6 mouse. (E) CXCL15 immunoreactivity (green) is seen in the alveolar and bronchoepithelial cells of the lung of a C57BL/6 mouse. Staining was done on a BALB/c and FVB mouse lung fixed in Bouins, and the staining was the same as the C57BL/6 mouse lung (data not shown). (F) Anti-CXCL15 immunoreactivity in the lung is blocked by pre-incubation with CXCL15 protein, demonstrating antibody specificity. Bar = 50 m. 29 pan-cortical region, with increased intensity in the zona glomerulosa (Figure 2A). In the trachea, CXCL15 is located in the pseudostratified epithelial cells (Figure 2B). In Figure 2C, CXCL15 can be found in the upper part of the colonic gland as well as in the colonic goblet cells. In the uterus, CXCL15 is observed in the endometrium (Figure 2D). The spleen did not show positive immunostaining for CXCL15, confirming the lack of mRNA expression (data not shown). Specificity of CXCL15 Immunofluorescence in Pulmonary Tissue Since the expression of CXCL15 protein had been previously demonstrated only in BALB/c lung bronchoepithelial cells, we wanted to determine if our biotinylated goatanti-mouse CXCL15 detected a similar staining pattern in C57BL/6J lung tissue (2). As can be seen in Figure 2E, there is expression of CXCL15 in the C57BL/6J lung in cells in both the lung parenchyma and bronchoepithelial cells. Expression of CXCL15 was also analyzed in BALB/cJ and FVB/N mouse lungs, and a similar pattern of expression was seen (data not shown). To determine if the lung parenchymal cells stained by CXCL15 were bone marrow derived, cells were co-stained with antibodies to CD45+; there was no co-localization of the two stains (data not shown). Antibody blocking studies were performed to determine the specificity of the immunofluorescence. After preincubation of the CXCL15 antibody with CXCL15 peptide, no immunofluorescence was detected in the lung, indicating that the immunofluorescence was specific for CXCL15 (Figure 2F). 30 CXCL15 Expression in Gastric Epithelial Cells As our laboratory has extensive expertise in the study of gastric epithelial biology, we next performed double immunofluorescent studies to determine the exact expression pattern of CXCL15 in the stomach (20). The two mucus producing cell types – surface mucus cells and mucus neck cells – produce mucin and trefoil factors that form the mucus layer, which acts to protect the surface of the stomach from the acidic luminal environment (21). These cells are identified by their expression of mucin glycoproteins which react with the cholera toxin B (CTB) subunit (Figure 3A) and the lectin GSII (Figure 3G), respectively (20). The parietal cells, found mostly in the zymogenic zone and mucoparietal zone, express H+/K+ -ATPase, which is responsible for the production of the acidic environment in the lumen (Figure 3D). The zymogenic (chief) cells that are found in the zymogenic zone secrete proteins, such as pepsinogen (Figure 3J) and intrinsic factor (Figure 3M), needed for digestion and absorption of vitamin B12 respectively. Based on Figures 3C, F, I, L, and O, it can be seen that CXCL15 immunostaining colocalized with a subset of cells expressing pepsinogen and intrinsic factor. This staining pattern identifies the CXCL15 expression gastric cell type as the pre-zymogenic and zymogenic cell. CXCL15 does not appear to be expressed by parietal cells, surface mucus cells or the pure mucus neck cell population. Expression of CXCL15 in H. felis-infected Mice Since chemokines play a role in the movement of inflammatory cells, the expression of ELR+ CXC chemokines was analyzed in our H. felis model of gastric 31 32 Figure 3: CXCL15 expression in gastric prezymogenic cells. (A – C) Identification of surface mucus cells through lectin staining with CTB (red in A), indicates that CXCL15 (green in B) is not expressed in surface mucus cells. (D – F) H+/K+ -ATPaseimmunoreactive parietal cells (red in D) and CXCL15-immunoreactivity (green in E) do not colocalize (F), indicating that parietal cells do not express CXCL15 protein. (G – I) GSII lectin reactivity (red in G) identifying pure mucus neck cells demonstrates that CXCL15 (green in H) is also not expressed in the main mucus neck cell population. (J – L) Pepsinogen immunoreactivity (red) is seen in a subset of mucus neck and zymogenic cells (red in J). This staining pattern is similar to CXCL15 (green in K) and expression between pepsinogen and CXCL15 is colocalized in panel L (yellow). (M – O) Immunolocalization of intrinsic factor (M, red) in zymogenic cells and CXCL15 (green in N), indicates a limited number of cells showing colocalization. The arrow in O indicates the positive colocalization staining between the two. These results are consistent with the expression of CXCL15 in pre-zymogenic cells that are in the process of differentiating into mature zymogenic cells. Bar = 50 m. 33 inflammation. This model develops a severe chronic active gastritis that is responsible for a series of epithelial alterations, including atrophy, metaplasia, and dysplasia, which ultimately results over 12-15 months in gastric adenocarcinoma formation (16, 22, 23). Figure 4A shows the normal stomach glandular zone of an 8-week mock-infected C57BL/6 stomach, while Figure 4B demonstrates the dramatically altered epithelial glandular architecture and inflammatory infiltrate in the stomach of a C57BL/6J mouse infected with H. felis for eight weeks. Figure 4G shows that CXCL15 mRNA expression is increased in 8-week H. felis infected stomachs, when compared to the CXCL15 expression in 8-week mock C57BL/6 stomachs (the mock experimental control was assigned a fold change of 1). Supplemental Figure 1 shows CXCL15 immunofluorescent staining in a mock (1A) and H.felis infected stomach (1B). At this timepoint, there is a loss of zymogenic cells and a massive expansion of the dysplastic mucus neck cell population. This dysplastic population shows a diffuse staining of CXCL15, which correlates with the increase in mRNA expression shown in Figure 4G. Expression of CXCL15 in Two Murine Models of Colitis Currently our laboratory investigates two mouse model of inflammatory bowel disease. One model utilizes the FVB.mdr1a-/- mouse (multidrug-resistance gene), which spontaneously develops intestinal inflammation if housed under specific pathogen-free conditions (19). The mdr1a gene encodes a 170 kDa transmembrane transporter protein known as P-glycoprotein, which is part of the adenosine triphosphate binding transporter family and found in the murine distal small intestine and colon (24, 25). The second model of IBD involves the transfer of regulatory T cell-deficient lymphocyte subsets into 34 immunodeficient B6.Rag-1-/- mice. Different permutations of this model include transfer of CD45RBhi or CD62L-enriched T cells, as well as T cells from regulatory cytokinedeficient mice (26-28). In these studies we used a previously reported model of colitis induction in which transfer of CD4+ T cells from uninfected C57BL/6 donor mice induces colitis upon transfer to Helicobacter hepaticus-infected, immunodeficient B6.Rag-/- mice (17). Colonic expression of CXCL15 was tested in both of these models and surprisingly the expression was decreased in mice with severe colitis, the opposite of our results in the gastritis model (Figure 4G). Figure 4C shows the normal uninflamed colon from an FVB/N mouse and 4D demonstrates the extensive inflammatory infiltrate and gland thickening that spontaneously occurs in a 6 month old FVB.mdr1a-/- mouse. Figure 4E shows an absence of inflammation in a mock-infected B6.Rag-1-/- recipient of CD4+ T cells that do not develop diarrhea or colitis. However, the colon from an H. hepaticusinfected B6.Rag-1-/- recipient of CD4+ T cells, that do develop diarrhea, demonstrates severe intestinal inflammation (Figure 4F). Supplemental Figure 1 shows the expression of CXCL15 by immunofluorescence in these two colitis models. Unlike the gastritis model it can be seen that the protein level of CXCL15 is unchanged or slightly decreased with colitis, correlating with the mRNA data in Figure 4G. ELR+ CXC Chemokine Expression in Gastric and Intestinal Models of Inflammation As CXCL15 is a member of the ELR+ CXC chemokine family, we contrasted its expression in our gastric and one of our intestinal models of inflammation with the other 35 36 Figure 4: Histology and CXCL15 expression in gastric (A, B) and colonic (C-F) models of inflammation. Hematoxylin/eosin (H/E) of C57BL/6 stomachs at eight weeks after mock (A) or H. felis (B) infection. Notice the extensive inflammation seen after infection. FVB/N (C) and FVB.mdr1a-/- (D) colons at 5 months of age. Note the increase in inflammation in panel D. H&E stains of colons from B6.Rag-1-/- recipients of CD4+ T cells from uninfected B6 mice reveals normal colonic architecture in uninfected recipients (E), but severe inflammation in H. hepaticus-infected recipients (F). mRNA expression of CXCL15 in each inflammation model (G). Each model is normalized to the CXCL15 expression in the non-inflamed control. The H. felis infection for 8 weeks increased the expression of CXCL15, whereas CXCL15 expression was decreased in both the spontaneous and the infectious model of colonic inflammation (n = 3). Bar = 50 m. 37 Figure 5: The expression of ELR+ CXC chemokines in select tissues of the gastrointestinal tract. (A) Gastric expression of ELR+CXC chemokines in mice infected for 8 weeks with H. felis. The expression at one represents the expression of each chemokine in the mock-infected animals. (B) Colonic expression in the FVB.mdr1a-/model of the ELR+CXC chemokines. The expression at one represents the expression of each chemokine as compared to non-colitic FVB. n = 3 animals. 38 members of the murine ELR+ CXC chemokine family: KC, LIX, and MIP2. As can be seen in Figure 5A, gastric expression of only two of these ELR+ CXC chemokines, CXCL15 and LIX, is increased in C57BL/6 mice infected with H. felis for eight weeks, as compared to the expression levels in mock-infected animals. Additionally, mdr1a-/mice on the FVB background develop severe colitis and have increased colonic expression of MIP-2, LIX, and KC without an increase in CXCL15 as can be seen in Figure 5B. All three models of inflammation have a significant component of neutrophils in the inflammatory infiltrate (Supplementary Figure 2). As CXCL15 is not increased in the two models of colitis, but is increased in the gastritis model, it is unclear if it plays any role in this neutrophil chemotaxis. 39 DISCUSSION Our findings clearly demonstrate that CXCL15 expression, at both the mRNA and protein level, is not restricted to the adult lung. The original report of CXCL15 expression analyzed its expression in tissues by Northern Blot. In a paper by Mocharla et al. it was shown that reverse transcriptase PCR is approximately 1000 fold more sensitive than northern blot (29). Our qRT-PCR data indicate that the level of expression in all tissues, with the exception of the adrenal gland, is approximately 1000-fold less than the extremely high levels seen in the lung, therefore accounting for the “lack of expression” previously determined using northern blot analysis. It should be noted that Mocharla and coworkers did not analyze CXCL15 expression from many of the tissues investigated in the current study. mRNA was isolated from the tissues reported in the original Northern Blot, and in agreement with their findings, no expression was seen. Because our demonstration of CXCL15 expression in multiple mucosal and glandular tissues of the C57BL/6J mouse was different than expression reported in the original reports showing limited expression of CXCL15 in the BALB/c murine lung, we tested several different mouse strains (including Balb/cJ and FVB/N) to determine if the expression we observed was strain specific. All strains showed similar patterns of expression, indicating that our findings were not specific for the C57BL/6J strain. As the expression of CXCL15 in mRNA and protein is not a direct one to one ratio, it appears that CXCL15 may be regulated at both the RNA and protein level. Further studies will need to be preformed to determine where the mechanisms of this regulation. 40 Although our results clearly demonstrated low level mRNA and protein expression in multiple mucosal and endocrine tissues, they did not indicate what cell type(s) were involved in producing CXCL15. Immunohistochemical experiments on selected tissues clearly demonstrated expression in the epithelial layers of multiple organs including the lung, trachea, colon, uterus, stomach, and small intestine (data not shown). The function of CXCL15 at these epithelial surfaces would be expected to be similar to its identified role in the lung, i.e. to induce neutrophil migration into sites of inflammation and infection. As there are multiple differentiated epithelial cell types in the stomach, we sought to determine which of these cell types expressed CXCL15. Through the utilization of cell-specific expression markers, the transitional prezymogenic and the mature zymogenic cell were identified as the only cell types that expressed CXCL15 in the stomach. Pre-zymogenic cells are a group of cells producing secretory granules, which appear intermediate between the granules in mucus neck cells and those of zymogenic cells. These cells eventually differentiate into mature zymogenic cells; however, it is not clear how long cells spend in this transition phase (30). They appear to share functions with zymogenic cells and mucus neck cells, i.e. the production of mucus. The pre-zymogenic cells produce primarily pepsinogen, which is cleaved into active pepsin by hydrochloric acid released by gastric parietal cells. This pepsin then digests ingested food proteins. It is currently unclear what role CXCL15 would play in this transitional cell type. As CXCL15 is upregulated in response to multiple pulmonary inflammatory stimuli, we postulated that CXCL15 expression might also be upregulated in gastrointestinal inflammatory diseases. The most common cause of gastric inflammation 41 in humans is H. pylori infection (31); therefore we utilized a mouse model of Helicobacter-induced gastritis to investigate this hypothesis. As predicted, CXCL15 expression was upregulated during experimental Helicobacter infection. The function of CXCL15 in this model of inflammation could be to recruit neutrophils, as both human and mouse Helicobacter-associated gastritis have a significant neutrophil infiltrate (32) and Supplementary Figure 2. In addition, as this model of gastritis progresses over time to gastric adenocarcinoma, it is intriguing to speculate that CXCL15 could also play a role in this progression towards gastric epithelial cancer (33-35). One potential mechanism for this involvement could be the role of CXCL15 as a chemoattractant for bone marrow progenitor cells, as it has been recently reported that Helicobacterassociated gastric cancer originates from bone marrow stem cells (3, 36). Contrary to what we saw in the H. felis-associated gastritis model, the expression of CXCL15 was decreased in two models of murine colitis. As both models have mild to moderate Gr-1+ neutrophil infiltrate, this implies that these neutrophils are recruited by chemokines other than CXCL15 (19, 37) and Supplementary Figure 2. Our results imply that CXCL15 does not play a significant role in either CD4-mediated infectious or spontaneous murine colitis. In order to investigate other potential mechanisms for neutrophil chemoattraction in both the Helicobacter-associated gastritis and the spontaneous FVB.mdr1a-/- colitis models, we decided to investigate the presence of other ELR+ CXC chemokines in the gastrointestinal tract. Analysis of the 8-week infected H. felis gastritis model demonstrated that expression of LIX and CXCL15 chemokines were increased. Intriguingly, the pattern of inflammation-associated expression of ELR+ CXC 42 chemokines was different in the FVB.mdr1a-/- model, as expression of KC, LIX, and MIP2 was increased, while CXCL15 expression was decreased. In conclusion, CXCL15 (lungkine) can no longer be considered a lung-specific chemokine. The low level expression in multiple mucosal tissues implies a much broader role in inflammatory disease than just localized pulmonary inflammation. The localization of CXCL15 to epithelial cells implies that part of its function could be to sense external infection and initiate immune responses. However the actual functional role of CXCL15 in gastrointestinal disease remains to be elucidated. 43 ACKNOWLEDGEMENTS This work was supported in part by American Cancer Society Grant RPG-99-08601-MBC, the NIH grants R01 DK059911, P01 DK071176, and the University of Alabama at Birmingham Digestive Diseases Research Development Center Grant #P30 DK064400. JMS received salary support from the NIH training grant T32 AI07041. We would like to thank Camalla Kimbrough and Andrea Stanus for expert technical assistance. 44 REFERENCES 1. Barnes, P. J. 2003. Cytokine-directed therapies for the treatment of chronic airway diseases. Cytokine Growth Factor Rev 14:511. 2. Rossi, D. L., S. D. Hurst, Y. Xu, W. Wang, S. Menon, R. L. Coffman, and A. Zlotnik. 1999. Lungkine, a novel CXC chemokine, specifically expressed by lung bronchoepithelial cells. J Immunol 162:5490. 3. Ohneda, O., K. Ohneda, H. Nomiyama, Z. Zheng, S. A. Gold, F. Arai, T. Miyamoto, B. E. Taillon, R. A. McIndoe, R. A. Shimkets, D. A. Lewin, T. Suda, and L. A. Lasky. 2000. WECHE: a novel hematopoietic regulatory factor. Immunity 12:141. 4. Chen, S. C., B. Mehrad, J. C. Deng, G. Vassileva, D. J. Manfra, D. N. Cook, M. T. Wiekowski, A. Zlotnik, T. J. Standiford, and S. A. Lira. 2001. Impaired pulmonary host defense in mice lacking expression of the CXC chemokine lungkine. J Immunol 166:3362. 5. Frederick, M. J., and G. L. Clayman. 2001. Chemokines in cancer. Expert Rev Mol Med 2001:1. 6. Zlotnik, A., and O. Yoshie. 2000. Chemokines: a new classification system and their role in immunity. Immunity 12:121. 7. Strieter, R. M., M. D. Burdick, J. Mestas, B. Gomperts, M. P. Keane, and J. A. Belperio. 2006. Cancer CXC chemokine networks and tumour angiogenesis. Eur J Cancer 42:768. 8. Moepps, B., E. Nuesseler, M. Braun, and P. Gierschik. 2006. A homolog of the human chemokine receptor CXCR1 is expressed in the mouse. Mol Immunol 43:897. 9. Maheshwari, A., R. D. Christensen, D. A. Calhoun, R. A. Dimmitt, and A. Lacson. 2004. Circulating CXC-chemokine concentrations in a murine intestinal ischemia-reperfusion model. Fetal Pediatr Pathol 23:145. 10. Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156. 11. Bas, A., G. Forsberg, S. Hammarstrom, and M. L. Hammarstrom. 2004. Utility of the housekeeping genes 18S rRNA, beta-actin and glyceraldehyde3-phosphate-dehydrogenase for normalization in real-time quantitative 45 reverse transcriptase-polymerase chain reaction analysis of gene expression in human T lymphocytes. Scand J Immunol 59:566. 12. Heid, C. A., J. Stevens, K. J. Livak, and P. M. Williams. 1996. Real time quantitative PCR. Genome Res 6:986. 13. McLoughlin, R. M., R. M. Solinga, J. Rich, K. J. Zaleski, J. L. Cocchiaro, A. Risley, A. O. Tzianabos, and J. C. Lee. 2006. CD4+ T cells and CXC chemokines modulate the pathogenesis of Staphylococcus aureus wound infections. Proc Natl Acad Sci U S A 103:10408. 14. Brown, J. K., A. D. Pemberton, S. H. Wright, and H. R. Miller. 2004. Primary antibody-Fab fragment complexes: a flexible alternative to traditional direct and indirect immunolabeling techniques. J Histochem Cytochem 52:1219. 15. Burry, R. W. 2000. Specificity controls for immunocytochemical methods. J Histochem Cytochem 48:163. 16. Roth, K. A., S. B. Kapadia, S. M. Martin, and R. G. Lorenz. 1999. Cellular immune responses are essential for the development of Helicobacter felisassociated gastric pathology. J Immunol 163:1490. 17. Kullberg, M. C., D. Jankovic, P. L. Gorelick, P. Caspar, J. J. Letterio, A. W. Cheever, and A. Sher. 2002. Bacteria-triggered CD4(+) T regulatory cells suppress Helicobacter hepaticus-induced colitis. J Exp Med 196:505. 18. Burich, A., R. Hershberg, K. Waggie, W. Zeng, T. Brabb, G. Westrich, J. L. Viney, and L. Maggio-Price. 2001. Helicobacter-induced inflammatory bowel disease in IL-10- and T cell-deficient mice. Am J Physiol Gastrointest Liver Physiol 281:G764. 19. Panwala, C. M., J. C. Jones, and J. L. Viney. 1998. A novel model of inflammatory bowel disease: mice deficient for the multiple drug resistance gene, mdr1a, spontaneously develop colitis. J Immunol 161:5733. 20. Lorenz, R. G., and J. I. Gordon. 1993. Use of transgenic mice to study regulation of gene expression in the parietal cell lineage of gastric units. J Biol Chem 268:26559. 21. Ito, S. 1987. Functional Gastric Morphology. In Physiology of the Gastrointestinal Tract, p. 817. 22. McCracken, V. J., S. M. Martin, and R. G. Lorenz. 2005. The Helicobacter felis model of adoptive transfer gastritis. Immunol Res 33:183. 46 23. Cai, X., J. Carlson, C. Stoicov, H. Li, T. C. Wang, and J. Houghton. 2005. Helicobacter felis eradication restores normal architecture and inhibits gastric cancer progression in C57BL/6 mice. Gastroenterology 128:1937. 24. Elson, C. O., Y. Cong, V. J. McCracken, R. A. Dimmitt, R. G. Lorenz, and C. T. Weaver. 2005. Experimental models of inflammatory bowel disease reveal innate, adaptive, and regulatory mechanisms of host dialogue with the microbiota. Immunol Rev 206:260. 25. Stephens, R. H., J. Tanianis-Hughes, N. B. Higgs, M. Humphrey, and G. Warhurst. 2002. Region-dependent modulation of intestinal permeability by drug efflux transporters: in vitro studies in mdr1a(-/-) mouse intestine. J Pharmacol Exp Ther 303:1095. 26. Powrie, F., M. W. Leach, S. Mauze, S. Menon, L. B. Caddle, and R. L. Coffman. 1994. Inhibition of Th1 responses prevents inflammatory bowel disease in scid mice reconstituted with CD45RBhi CD4+ T cells. Immunity 1:553. 27. Asseman, C., S. Mauze, M. W. Leach, R. L. Coffman, and F. Powrie. 1999. An essential role for interleukin 10 in the function of regulatory T cells that inhibit intestinal inflammation. J Exp Med 190:995. 28. Mudter, J., S. Wirtz, P. R. Galle, and M. F. Neurath. 2002. A new model of chronic colitis in SCID mice induced by adoptive transfer of CD62L+ CD4+ T cells: insights into the regulatory role of interleukin-6 on apoptosis. Pathobiology 70:170. 29. Mocharla, H., R. Mocharla, and M. E. Hodes. 1990. Coupled reverse transcription-polymerase chain reaction (RT-PCR) as a sensitive and rapid method for isozyme genotyping. Gene 93:271. 30. Karam, S. M. 1999. Lineage commitment and maturation of epithelial cells in the gut. Front Biosci 4:D286. 31. Kusters, J. G., A. H. van Vliet, and E. J. Kuipers. 2006. Pathogenesis of Helicobacter pylori infection. Clin Microbiol Rev 19:449. 32. Dundon, W. G., H. Nishioka, A. Polenghi, E. Papinutto, G. Zanotti, P. Montemurro, G. G. Del, R. Rappuoli, and C. Montecucco. 2002. The neutrophil-activating protein of Helicobacter pylori. Int J Med Microbiol 291:545. 33. Nomura, S., T. Baxter, H. Yamaguchi, C. Leys, A. B. Vartapetian, J. G. Fox, J. R. Lee, T. C. Wang, and J. R. Goldenring. 2004. Spasmolytic polypeptide 47 expressing metaplasia to preneoplasia in H. felis-infected mice. Gastroenterology 127:582. 34. Cahill, R. J., C. Kilgallen, S. Beattie, H. Hamilton, and C. O'Morain. 1996. Gastric epithelial cell kinetics in the progression from normal mucosa to gastric carcinoma. Gut 38:177. 35. Lynch, D. A., N. P. Mapstone, A. M. Clarke, G. M. Sobala, P. Jackson, L. Morrison, M. F. Dixon, P. Quirke, and A. T. Axon. 1995. Cell proliferation in Helicobacter pylori associated gastritis and the effect of eradication therapy. Gut 36:346. 36. Houghton, J., C. Stoicov, S. Nomura, A. B. Rogers, J. Carlson, H. Li, X. Cai, J. G. Fox, J. R. Goldenring, and T. C. Wang. 2004. Gastric cancer originating from bone marrow-derived cells. Science 306:1568. 37. Li, X., J. G. Fox, M. T. Whary, L. Yan, B. Shames, and Z. Zhao. 1998. SCID/NCr mice naturally infected with Helicobacter hepaticus develop progressive hepatitis, proliferative typhlitis, and colitis. Infect Immun 66:5477. 48 Supplementary Figure 1: Expression of CXCL15 (green) was evaluated by immunofluorescence in the three inflamed models of inflammation. The expression pattern in a mock stomach (A) and H. felis-infected stomach after eight weeks (B). Notice the increase of CXCL15 in the gastritis model. Figure 1C – F show CXCL15 expression in the colitis models. Figure 1C shows the expression in the FVB/N mouse colon and (D) shows the expression in the FVB.mdr1a-/- colon at 5 months of age. The last two panels are colons from uninfected B6.Rag-1-/- recipients (E) or H. hepaticus infected B6.Rag-1-/recipients (F) of CD4+ T cells from uninfected B6 mice. Note the slight decrease in CXCL15 expression in panel D and F. Bar = 50 m. 49 Supplementary Figure 2: Immunofluorescent analysis of neutrophils in the gastritis and colitis models. A biotinylated rat-anti-mouse Gr-1 (Ly-6G) (clone RB6-8C5; BD Pharmingen, San Diego, CA; 0.1 g/mL) was used to detect neutrophils. Visualization was by Streptavidin-HPR and Cy3-Tyramide. Figures 2 A and B show the expression of neutrophils in a mock-infected stomach (A) and a H. felis-infected stomach after eight weeks (B). Note the absence of neutrophils in panel A but an increase once the stomach becomes inflamed as seen in panel B. FVB/N (C) and FVB.mdr1a-/- (D) colons showing the staining for neutrophils. Again notice the absence of neutrophils in the non-inflamed but the infiltration of neutrophils in the inflamed model. The last two panels show the expression of neutrophils in the uninfected B6.Rag-1-/- recipients (E) or H. hepaticus infected B6.Rag-1-/- recipients (F) of CD4+ T cells from uninfected B6 mice. Again notice the absence of neutrophils in the non-inflamed colon but an increase in the inflamed colon. Bar = 50 m. 50 ROLE OF ADAPTIVE IMMUNITY IN MUCUS ALTERATIONS ASSOCIATED WITH GASTRIC HELICOBACTER INFECTION by JULIA M. SCHMITZ, ROBIN G. LORENZ In preparation for Journal of Histochemistry and Cytochemistry Format adapted for dissertation 51 Abstract Mucins and trefoil factors interact to form the protective mucus covering of the stomach in mice and humans. During the histological progression from a normal human gastric mucosa to gastric adenocarcinoma, multiple changes are seen in both the epithelium as well as the mucus layer. The C57BL/6 mouse model has been shown to progress from normal mucosa to gastric adenocarcinoma after H. felis infection. Therefore, we utilized this model to analyze the epithelial expression of the mucins and trefoil factors during disease progression by both qRT-PCR and immunofluorescence. The mouse model of disease mimics many of the mucin changes seen in human infection, including increases in Muc4, Muc5b, and decreases in TFF1. Contrary to the human disease, Muc5ac expression appeared unchanged by RNA expression. However, when analysis was done by immunofluorescene to determine the pattern and location of expression after infection, a significant decrease in expression in the body of the stomach was evident as early as 4 weeks after infection. This loss was prior to the development of significant metaplasia or dysplasia. This decrease in Muc5ac expression does not appear to be a result of the adaptive immune response as similar changes in expression were see after infection of B6.Rag-/- mice, which lack B and T cells. Intriguingly, the increases in Muc4 and Muc5b were not seen in infected B6.Rag-/- mice, indicating a clear role for adaptive immunity in these mucin alterations. 52 Introduction Gastric Cancer is the second leading cause of cancer death worldwide and is associated with Helicobacter pylori infection (Parkin et al. 2005; Vanagunas 1998). Based on the Laurén System, there are two types of gastric adenocarcinoma – diffuse and intestinal (Lauren 1965). The diffuse type is characterized by a poorly differentiated epithelium and has transmural invasion with lymphatic spread. It is more commonly seen in younger people and affects women more than men. The intestinal type is more common with increasing age and in males. It is associated with environmental exposures, including H. pylori infection and diets high in nitrates, and has been proposed to develop in a stepwise progression from normal gastric epithelium to gastritis, atrophy, intestinal metaplasia, dysplasia, and finally adenocarcinoma (Correa 1988). The initial gastritis is a development of both active (neutrophils) and chronic (monocytes and lymphocytes) inflammation in the stomach that is triggered by the gastric Helicobacter infection. This is often followed by gastric atrophy where the specialized cells, such as parietal and zymogenic cells, are lost resulting in an increased pH in the stomach. In a small number of susceptible patients, this is followed by intestinal metaplasia, which is marked by decreases in gastric mucin expression and increases in intestinal mucins. The final stage prior to adenocarcinoma development is dysplasia, which is marked by abnormal growth or development of cells. Early gastric adenocarcinomas are confined to the gastric mucosa and submucosa, while advanced cancers extend into the muscle wall (Fox et al. 1993; Leung and Sung 2002). The C57BL/6 mouse model of disease utilizes the closely related gastric Helicobacter, H. felis, to initiate gastritis and subsequent 53 gastric pathology (Lee et al. 1990; McCracken et al. 2005; Mohammadi et al. 1996). Cai, et.al. have reported that in C57BL/6 mice infected for 15 months, 100% of infected mice have progressed to gastric adenocarcinoma (Cai et al. 2005). One of the hallmarks of human gastric adenocarcinoma is the alterations in the types of mucins expressed, from gastric mucins to intestinal-type mucins (Correa 1988). Mucus, a gel-like substance that covers the mammalian epithelial surfaces of tissues, is composed of mucin glycoproteins and trefoil factors (TFF) (Chen et al. 2004; Kaneko et al. 2003). Mucus acts as both a lubricant and also as a protective barrier between the contents of the stomach and the mucosal epithelial surface (Shirazi et al. 2000). In humans, twenty-one mucins have been identified in tissues such as lung, nose, salivary glands, and gastrointestinal tract (Chen et al. 2004; Higuchi et al. 2004). Seven mucins have been identified in mice (Muc1, 2, 3, 4, 5ac, 5b, and 6) which are homologous to the human mucins. Mucins consist of a protein backbone with many carbohydrate side chains as well as tandem repeats of serine, theroine, and proline. The mucins are heavily gylcosylated and they are thought to play a role in the bacterial colonization of the gastric mucosa (de Bolos et al. 2001). There are two types of mucins – membrane bound (Muc1, 3, and 4) and secreted (Muc2, 5ac, 5b, and 6) (Kawakubo et al. 2004; Ringel and Lohr 2003). The secreted mucins are conserved between the human and mouse forms (Escande et al. 2004). In normal human gastric mucosa, MUC1 and MUC5AC are expressed in the superficial epithelium, while MUC6 is localized to the deep glands and the mucus neck cells. MUC2, MUC3, MUC4, and MUC5B are not normally expressed in the human gastric mucosa (Babu et al. 2006; Ho et al. 1995; Pinto-de-Sousa et al. 2004). 54 In humans and mice there are three trefoil factors: TFF1/pS2, TFF2/spasmolytic polypeptide (SP), and TFF3/intestinal trefoil factor (ITF). Trefoil factors are small, soluble peptides with trefoil or P domains. The trefoil domains are made up of six cysteines residues (Hoffmann and Hauser 1993; Katoh 2003). Trefoil factors are secreted from the granules in the mucus secreting cells (Clyne et al. 2004). Trefoil peptides act as scaffolding for the mucins within the stomach, with specific TFFs cross linking with mucins to help form the gel layer in the stomach (Clyne et al. 2004; Shirazi et al. 2000). TFF1 is normally found in the superficial cells of the body and antral mucosa of the stomach, while TFF2 is found in the mucus neck cells of the body and antral glands in the stomach. TFF3 is normally not expressed in the stomach, but is expressed in the intestine and the salivary glands (Wong et al. 1999). Previous studies in humans showed that TFF1 interacts with MUC5AC, TFF2 interacts with MUC6, and TFF3 interacts with MUC2 (Clyne et al. 2004; Ruchaud-Sparagano et al. 2004). Changes have been seen in the expression of mucins and TFFs in gastric adenocarcinoma. MUC1 has been shown to be expressed early in the infection process but is decreased during the metaplastic stage (Wang and Fang 2003). MUC2, MUC3, MUC4, MUC5B, and TFF3 are not expressed in the normal human stomach, but are expressed in gastric adenocarcinoma biopsies. This contrasts with MUC5AC, which is expressed in a normal stomach but not in gastric adenocarcinoma (Dhar et al. 2005; Ho et al. 1995; Marques et al. 2005; Pinto-de-Sousa et al. 2004; Roessler et al. 2005; Wang and Fang 2003). MUC6 is expressed at high levels in a normal human stomach in the mucus neck cells and the antrum but is absent in gastric epithelium altered by gastric cancer (Ho et al. 1995; Pinto-de-Sousa et al. 2004). TFF1 has been shown to be lost in 50% of gastric 55 carcinomas (Muller and Borchard 1993; Wong et al. 1999). TFF2 expression was detected by immunohistochemistry in human stomach biopsies demonstrating gastritis and atrophy but not during intestinal metaplasia and gastric carcinoma (Hu et al. 2003). TFF3 is found in the stomach as it progresses through the intestinal metaplasia stage and is conserved in gastric cancer (Taupin et al. 2001). In the aforementioned studies MUC1, MUC2, and MUC6 expression was characterized by both RNA expression and immunohistochemistry staining. MUC3 and MUC4 expression was characterized by RNA. MUC5AC, MUC5B, TFF1, TFF2, and TFF3 were characterized only by immunohistochemistry. Previous studies have shown that H. pylori will bind to both Muc5ac and TFF1 in the stomach, both of which have decreased expression during the progression to gastric adenocarcinoma (Clyne et al. 2004; Van De Bovenkamp et al. 2005; Van den Brink et al. 2000). As the H. felis infected C56BL/6 model of disease is now widely utilized to study the mechanisms of cancer development, we initiated experiments to determine how closely this mimics the human pathology. Previous studies have concentrated on the expression of trefoil factors, specifically TFF1 and TFF2, in the mouse model, but there has been no comprehensive analysis of all the murine mucins and TFFs over the course of the disease (Kurt-Jones et al. 2007; Nomura et al. 2004). TFF2-/- mice have been infected with H. felis and shown to have an increased susceptibility to H. felis gastritis (Kurt-Jones et al. 2007). Another study infected TFF2-/- with H. pylori (SS1) and showed increased IFN in the mice suggesting a protective role for TFF2 by moderating the levels of IFN (Fox et al. 2007). It is also thought that spasmolytic peptide expressing metaplasia (SPEM) a lineage of TFF2 could be a marker for dysplasia in cancer as it was 56 detected by immunohistochemistry and DNA microarrays analysis of gastric biopsies (Nomura et al. 2004). Glycoproteins, which contain mucins, are found on the surfaces of cancer cells. In gastrointestinal tumors the glycoproteins have been found to be altered in expression and could have an impact on the immune response and cell adhesion during the disease (Brockhausen 2003). Therefore, we investigated the alterations in gastric mucins and trefoil factors as the murine disease progresses from gastritis through dysplasia and metaplasia to gastric carcinoma by both immunohistochemistry and RNA expression. 57 Materials and Methods Murine model of H. felis infection C57BL/6 and C57BL/6J-Rag-1tm1Mom (B6.Rag-1-/-) strains between 6 and 10 weeks of age at the time of initial infection were fed autoclaved rodent chow (NIH-31, Harlan Teklad, Madison, WI) and water ad lib and maintained on a 12:12-hr light-dark schedule. Animal procedures and protocols were conducted in accordance with the Institution Animal Care and Use Committee at the University of Alabama at Birmingham (Birmingham, AL). Mice were mock-infected or infected with H. felis as described previously (Roth et al. 1999). Briefly, the mice were infected by oral gavage three times over a seven-day period with 5 X 107 CFU H. felis (ATCC 49179). This results in a ~100% infection efficiency in our laboratory. The mock-infected mice were infected with the sterile BHI/glycerol mixture without the bacteria. Tissue Preparation The mice were sacrificed using isofluorane inhalation followed by cervical dislocation. Immediately after sacrifice the tissues were removed and divided, with one half quick frozen in liquid nitrogen for total RNA isolation and the other half immersion fixed in Carnoy‟s solution (6:3:1 of 100% ethanol, chloroform, and glacial acetic acid) for immunohistochemistry. The tissue was fixed for 4 hours at 4oC, and then changed to an ethanol wash for 18-24 hours prior to paraffin embedding. Five-micron sections were cut on a microtome and attached to pre-cleaned microscope slices (Snowcoat X-tra, Surgipath; Richmond, IL). 58 Total RNA was isolated by the phenol and guanidine isothiocyanate method using Trizol® (Invitrogen; Carlsbad, CA)(Chomczynski and Sacchi 1987). Genomic DNA was removed from the extracted total RNA using the Turbo DNase kit (Ambion, Austin, TX). cDNA was made with equal amounts of mRNA (2 g), using the Transcriptor First Strand cDNA Synthesis Kit (Roche, Pensberg, Germany). Quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) was performed on the samples using Applied Biosystems Assays-On-Demand primer/probe sets and TaqMan Universal PCR Mix (Pe Applied Biosystems, Foster City, CA). The samples were analyzed on the Stratagene MX3000P real-time PCR Machine. See Table 1 for Applied Biosystems Assays-On-Demand primer/probe sets that were used. The fold change was determined as described in the Applied Biosystems manufactor‟s instructions (4371095 Rev A, PE Applied Biosystems, Foster City, CA). Briefly, the average crossing threshold of each housekeeping gene (18S) minus the average crossing threshold of each target gene to determine the relative expression (CT). The average CT of the experimental animals (Helicobacter-infected) is subtracted from the average control (mock-infected) Ct to determine the CT. The Ct is then used in the formula 2Ct to determine the fold change in mRNA expression. The upper and lower limits of fold change were determined by taking the averaged standard deviations of each experimental group taken through the above calculations (Bas et al. 2004; Heid et al. 1996). 59 Table I: Primer-Probe pairs utilized for qRT-PCR Gene Applied Biosystems Exons detected Gene ID Catalogue Number* by Probe 18S – housekeeping Hs99999901_s1 none X03205 gene Muc1 Mm00449604_m1 6–7 Mm.16193 Muc2 Mm00458299_m1 7–8 Mm.2041 Muc3 Mm01207056_m1 None Mm.7184 Muc4 Mm00466886_m1 7–8 Mm.214599 Muc5ac Mm01276725_g1 33 – 34 Mm.334332 Muc5b Mm00466376_m1 1–2 Mm.200752 Muc6 Mm00725165_m1 None NM_181729.1 TFF1 Mm00436945_m1 1–2 Mm.2854 TFF2 Mm00447491_m1 2–3 Mm.1825 TFF3 Mm00495590_m1 2–3 Mm.4641 *All genes were purchased from Applied Biosystems (Foster City, CA). 60 Histological and Immunofluorescent Scoring Systems All histological and immunofluorescent scores are determined by two observers blind to the experimental groups (RGL and JMS). Tissue sections were stained with hematoxin and eosin for histological analysis. The scoring system is a 0 to 9 scale (0 - no inflammation or epithelial changes; 9 – severe inflammation and extensive epithelial abnormalities) with subscores of 0 to 3 in each of the following three areas: longitudinal extent of inflammation, vertical extent of inflammation, and histological changes. Gastric cancer is determined histologically by an invasion of infiltrates through the muscularis layer. The scores are averaged between the blind scorers and graphed individually with the horizontal line indicating the median. Tissue sections were stained with the rabbit polyclonal anti-Helicobacter pylori antibody which cross reacts with H. felis (unpublished observation, SIG-3431; Convance, Emeryville, CA). Briefly, sections are deparrafinized by successive immersions in citrosolv (Fisher Scientific, Pittsburgh, PA) and isopropanol, and rehydrated with phosphate buffered saline (PBS). The tissues were pretreated with 0.25% pepsin in PBS for 10 minutes at r.t. and blocked with PBS-blocking buffer (1% bovine serum albumin and 0.3% Triton) for fifteen minutes to block non-specific binding and to allow the antibody access to cell surface and internal antigens. The slides were incubated with antiHelicobacter for one hour at r.t., (undiluted) washed in PBS, and incubated with Cy3 donkey anti-rabbit IgG (24 ng/mL; cat# 711-165-152; Jackson Immunoresearch, West Grove, PA) for one hour. The sections were counterstained with Hoechst dye (1 ng/mL; bis-benzimide, Cat# B2883, Sigma, St. Louis, MO) to visualize nuclei. Colonization is 61 scored in a semi-quantitative system, with a range of 0 to 4; where 0 = no bacteria per crypt, 1 = 1 – 2 bacteria per crypt, 2 = 3 – 10 bacteria per crypt, 3 = 11 – 20 bacteria per crypt, and 4 = >20 bacteria per crypt. Two scores are obtained for each tissue – one at the squamous-glandular epithelial junction and one from the antrum. The 2 scores for each mouse per section are averaged together. When the scores are graphed both sections are averaged together. Mucin and Trefoil Factor Immunofluorescence All slides were taken through the deparrafinzation steps as described earlier. Slides stained for Muc3, Muc4, and TFF1 were taken through an avidin and biotin block (cat#SP-2001; Vector Laboratories, Burlingame, CA) each for 15 minutes with a PBS wash in between. All stains required a 15 minute blocking step with PBS blocking buffer (which consists of 1% BSA and 0.3% Triton X-100) to block nonspecifically binding proteins and to provide access to the cell surface and antigens to the tissue. The slides were then incubated over night with one of the following antibodies: rabbit polyclonal anti-Muc1 (2 g/mL; cat#15481; Abcam, Cambridge, MA), chicken anti-mouse Muc3 synthetic peptide (1:200 dilution, HO29; kind gift of Dr. Samuel Ho, Minneapolis, MN) rabbit anti-mouse Muc4 synthetic peptide (1:200 dilution, HO4-2; kind gift of Dr. Samuel Ho) or goat polyclonal anti-TFF1/pS2 (2 g/mL; cat# sc-7843; Santa Cruz Biotechnology; Santa Cruz, CA). Secondary detection for Muc1 used Cy3 donkey antirabbit IgG. All other antibodies went through an additional biotin labeling step: biotin rabbit anti-chicken IgG (1:10,000; cat# 61-3140; Zymed, San Francisco, CA) for Muc3; biotin donkey anti-rabbit IgG (1:1000; cat# 711-065-152; Jackson Immunoresearch, West 62 Grove, PA) for Muc4 and biotin mouse anti-goat IgM ( 13 g/mL, cat# 115-065-068; Jackson Immunoresearch). Detection for these antibodies was with Cy3 Strepavidin (18 g/mL; cat# 016-106-084; Jackson Immunoresearch), followed by visualization nuclei of by Hoechst dye. Muc5ac immunofluorescene and evaluation Muc5ac expression was evaluated in the gastric epithelium through the use of a “mouse on mouse” protocol (Brown et al. 2004). Briefly the sections were deparaffinized, rehydrated, and blocked as described above. Mouse monoclonal IgG1 anti-Muc5ac (clone 45M1; 200 g/mL, cat# MS-145-PO, Thermo Scientific, Fremont, CA) and the Cy3 Fab goat anti-mouse secondary antibody (1.5 mg/mL; cat# 115-167003; Jackson Immunoresearch), were incubated together at a 1:2 ratio (w/w) in triton-free PBS blocking buffer for 40 minutes at room temperature (RT). Unbound Fab fragments were then bound with excess mouse serum at 1:100 final dilution for 10 minutes at room temperature before placed on the slide for one hour. Visualization of the nuclei was by Hoechst staining. The slides were score as described above, with the exception that the scoring is on a 0 – 3 scale with 0 = no staining and 3 = maximal staining. Each stomach section was scored in both the body and the antrum. The antrum scoring was used as an internal positive control as we determined that H. felis infection in our model only alters expression of Muc5ac in the body of the mouse stomach. Only slides that scored a 2 or 3 in the antrum were used for further analysis. 63 Microscope All histological and fluorescent photomicrographs were taken using a automated operated Zeiss® Axioskop 2 (Thornwood, NY) with an Axiocam® HRC camera. The software utilized was Axiovision® Release 4.6.3 (Zeiss). Graphic and Statistical Analysis For the qRT-PCR, graphs were made of the calculated mean fold change using the GraphPad Prism 4® (San Diego, CA). All the qRT-PCR graphs are horizontal with the yaxis set at one to represent the baseline expression of each gene for each animal for comparison. The mean fold change and range are graphed. Statistics were performed on all data using GraphPad InStat 3® (San Diego, CA) using an un-paired t-tests for continuous data. Uncontinuous data statistics was performed using the Mann Whitney U test. A p-value of <0.05 was considered significant. 64 RESULTS H. felis infection of C57BL/6 mice results in chronic active gastritis and gastric adenocarcinoma To investigate the timing of progression to gastric adenocarcinoma, female C57BL/6 mice were infected with H. felis and sacrificed at multiple time points over a one-year period (4, 8, 12, 16, 20, 24 and 52 weeks). Over the one-year time course, gastric inflammation and epithelial alterations are increased, with maximal histological scores seen 16 weeks into the infection (Fig. 1A). These histological changes are paralleled by a subsequent reduction in bacterial colonization, as is also reported in human disease (Fig. 1B) (Karnes et al. 1991; Kikuchi 2002). Figure 1C – G shows the representative histology at each time point (in comparison to a mock control). Figure 1C is a B6 mock-infected stomach, showing evidence of the normal glandular organization in the parietal zone of the murine stomach and no evidence of inflammation. The parietal cells, which are responsible for the gastric acidity of the stomach, are indicated by the arrows. Figure 1D is representative of gastritis in the mouse stomach, when the inflammatory infiltrates are first evident; this is four weeks into the infection. The next panel, 1E, is a stomach in atrophy, which occurs 12 – 16 weeks after the initial infection in the mouse. At this stage the parietal cells are lost and the immune infiltrates are still evident. Figure 1F is representative of a stomach in intestinal metaplasia, this usually occurs late in the infection (stomach after 24 weeks). This is when the stomach mimics an intestinal cellular structure especially with the appearance of the goblet cells. Figure 1G is a representation of gastric adenocarcinoma (52 weeks) with invasion of the dysplastic 65 Hf Colonization Score Histological Score 4 9 8 7 6 5 4 3 2 1 0 1 B6 mock B6 + Hf B6 + Hf B6 + Hf B6 + Hf B6 + Hf B6 + Hf B6 + Hf 8 wks 12 wks 16 wks 20 wks 24 wks 52 wks A D 4 wks 8 wks B Weeks C 2 0 B6 m ock B6 + Hf B6 + Hf B6 + Hf B6 + Hf B6 + Hf B6 + Hf B6 + Hf 4 wks 3 12 wks 16 wks 20 wks 24 wks 52 wks Weeks E F G Figure 1: Disease progression during H. felis infection in C57BL/6 mice. Figure 1A shows the histological scores of the B6 mouse over the course of the infection. 1B shows the colonization score over the course of the infection. In these two graphs the horizontal line represents the median score. The circles represent individual animals. Panels 1C through G are histological pictures during the course of the infection. 1C is a mock mouse showing the normal glandular structure of the stomach. 1D is a picture representing a stomach during gastritis, taken after 4 weeks of infection. 1E represents a stomach in gastric atrophy (16 weeks), followed by 1F which is a representation of intestinal metaplasia (52 weeks). Panel 1G is a histological representation of a 52 week infected stomach that has gastric adenocarcinoma as is indicated by the invasion of the infiltrates through the muscularis. 66 glands through the muscularis. In our facility 58% of our mice progress to gastric adenocarcinoma after 52 weeks of infection. Gene expression of Mucins and TFFs are altered after H. felis infection Quantitative real-time reverse transcriptase PCR (qRT-PCR) was performed on total gastric RNA samples taken at multiple time points during the infection process to determine the expression of mucins and TFFs. At each timepoint, the gene expression level in mock-infected gastric RNA is assigned a fold change of 1. To determine that the baseline expression of the mucins did not change over time, the fold change analysis was done on the mocks from the different time points comparing back to the 4 week mock. There was no significant change in the expression of the mock animals over the course of the experiment (data not shown). Table 2 shows the fold change and range for each mucin and TFFs over the course of the infection. Figure 2 shows several examples of trends in mucin gene expression over the course of the infection. Muc1 is shown in Figure 2A and represents the large number of mucins that showed no significant change in expression after H. felis infection as compared to the mock-infected stomachs. Other mucins and TFFs with this gene expression pattern were Muc2, Muc6, TFF1, and TFF2 (Table 2). The expression of Muc3 decreased over the course of infection (Fig. 2B), a pattern that was also seen with TFF3 (Table 2). Fig. 1C demonstrates an increase in Muc4 over the course of the infection especially at 20 and 24 weeks. This pattern is seen with Muc5b (Table 2). Surprisingly, the expression of Muc5ac by qRT-PCR in the total gastric RNA was unchanged (Fig. 2D). As immunohistochemical expression of this 67 Table II: Average Fold Change and +/- Range of Mucin Genes 4 weeks 8 weeks 12 weeks 16 weeks 1.22 2.45 2.66 0.628 Muc1 (0.246 – (0.259 – (1.52 – (0.0665 – 6.1) 23.197) 4.68) 5.93) 0.189 3.22 2.109 0.217 Muc2 (0.017 – (0.38 – (0.643 – (0.014 – 2.069) 27.4) 6.92) 3.43) 0.311 2.73 2.46 0.161 Muc3 (0.04 – (0.232 – (1.357 – (0.00569 – 2.45) 32.02) 4.448) 4.58) 0.576 0.0213 4.6375 7.5 Muc4 (0.048 – (0.00224 – (1.835 – (0.586 – 6.85) 0.2017) 11.723) 95.88) 0.0962 2.78 0.436 0.354 Muc5ac (0.0058 – (0.501 – (0.0593 – (0.022 – 1.58) 15.45) 3.201) 5.71) 8.23 1.756 6.301 0.857 Muc5b (0.782 – (0.136 – (4.002 – (0.094 – 86.76) 22.61) 9.92) 7.82) 0.317 4.37 3.094 0.857 Muc6 (0.0378 – (0.586 – (1.131 – (0.094 – 2.66) 32.597) 8.46) 7.82) 0.24 2.72 0.76 0.643 TFF1 (0.032 – (0.356 – (0.206 – (0.0617 – 1.75) 20.81) 2.8) 6.71) 1.79 4.672 1.18 0.534 TFF2 (0.322 – (0.641 – (0.472 – (0.0564 – 9.9) 34.056) 2.97) 5.049) 0.71 2.45 1.156 0.292 TFF3 (0.0867 – (0.34 – (0.424 – (0.022 – 5.82) 17.67) 3.15) 3.84) 68 20 weeks 2.021 (0.5439 – 7.51) 0.471 (0.164 – 1.359) 0.0262 (0.0077 – 0.0898) 15.63 (2.53 – 96.88) 0.999 ()0.274 – 3.65) 15.242 (2.957 – 78.56) 0.5 (0.18 – 1.38) 1.05 (0.321 – 3.43) 0.8497 (0.361 – 2) 0.37 (0.166 – 0.844) 24 weeks 1.18 (0.276 – 5.05) 1.615 (0.3789 – 6.89) 0.254 (0.076 – 0.85) 23.05 (3.98 – 133.52) 0.868 (0.23 – 3.32) 6.22 (0.847 – 45.71) 3.46 (0.66 – 18.17) 0.466 (1.12 – 1.463) 1.682 (0.469 – 6.03) 0.1667 (0.046 – 0.901) Muc1 Muc3 4 w eeks 8 w eeks 8 w eeks 12 w e e k s 12 w e e k s 16 w e e k s 16 w e e k s 20 w e e k s 20 w e e k s 24 w e e k s 24 w e e k s 4.9×10 -04 9.8×10 -04 2.0×10 -03 3.9×10 -03 7.8×10 -03 0.015616 0.031232 0.06246 0.1249 0.25 0.5 1 2 4 8 16 32 64 127.9 255.9 4.9×10 -04 9.8×10 -04 2.0×10 -03 3.9×10 -03 7.8×10 -03 0.015616 0.031232 0.06246 0.1249 0.25 0.5 1 2 4 8 16 32 64 127.9 255.9 4 w eeks A Fold Change B Muc4 Fold Change Muc5ac 4 w eeks 4 w eeks 8 w eeks 8 w eeks 12 w e e k s 12 w e e k s 20 w e e k s 20 w e e k s 24 w e e k s 24 w e e k s C Fold Change 4.9×10 -04 9.8×10 -04 2.0×10 -03 3.9×10 -03 7.8×10 -03 0.015616 0.031232 0.06246 0.1249 0.25 0.5 1 2 4 8 16 32 64 127.9 255.9 16 w e e k s 4.9×10 -04 9.8×10 -04 2.0×10 -03 3.9×10 -03 7.8×10 -03 0.015616 0.031232 0.06246 0.1249 0.25 0.5 1 2 4 8 16 32 64 127.9 255.9 16 w e e k s Fold Change D Figure 2: RNA expression of mucins over the course of infection. Panel 2A shows muc1 expression. Panel 2B shows the expression of muc3. Panel 2C shows the expression of muc4 over the course of the infection. Panel 2D shows the expression of muc5ac over the course of the infection. All infected animals are compared to their respective mockinfected controls at the same time points. The y-axis is set at one to represent the baseline expression in mock-infected controls. The mean and range for each time point is graphed. 69 mucin has been shown to be almost completely lost in human biopsies, we extended our investigations to include histological analysis of gastric expression of murine mucins. Mucin glycoprotein expression after H. felis infection As the majority of reports investigating mucin and TFF alterations in human gastric pathology focus on glycoprotein expression by immunohistochemisty, we evaluated the expression of selected mucins in our murine model of Helicobacterassociated gastric dysplasia and adenocarcinoma. By immunohistochemical analysis there was no change in the expression of Muc1 at 16 weeks, a finding consistent with the gene expression analysis (Fig. 3A, E). Immunohistochemical analysis of Muc3 expression in the mock (Fig. 3B) and 16 weeks infected stomach (Fig 3F) also showed no significant differences, however this contrasts with the gene expression data, which indicated a slight decrease in expression at later time points. There is a clear increase in the immunohistochemical expression of Muc4 (Fig. 3C, G) after 16 weeks of H. felis infection. This correlates with the RNA expression shown in Fig. 2. There is an almost complete loss of Muc5ac expression in the body of the 16 weeks H. felis infected stomach (Fig. 3D, H), which correlates with the lack of expression seen in human adenocarcinoma biopsies, but does not correlate with our RNA expression data. One potential explanation for this discrepancy is that Muc5ac expression is maintained in the antrum of mice infected with H. felis (data not shown). As our RNA expression data is for the total stomach, the technique may not be sensitive enough to pick-up this regionspecific loss of mucin expression. 70 A B C D E F G H Figure 3: Immunofluorescent analysis of mucins over the course of infection. Panel 3A (mock) and E (Helicobacter infected) shows stomachs stained with Muc1; there is no increase in the staining at 16 weeks. Panel 3B (mock) and F (Helicobacter infected) show 16 week B6 stomachs stained with Muc3 with no change in the staining. Panel C (mock) and G (Helicobacter infected) are B6 stomachs stained for Muc4, after 16 weeks. There is an increase in the staining in panel G. Panels D (mock) and H (Helicobacter infected) are 16 week B6 stomachs are stained for Muc5ac. There is a lost in the expression of Muc5ac in panel H in the gastric body. 71 Association of muc5ac immunofluorescence with gastric pathology MUC5AC is one of the main mucins whose expression is decreased in biopsies of gastric adenocarcinoma (Babu et al. 2006; Ho et al. 1995; Reis et al. 1997). As our gene expression data clearly did not correlate with immunohistochemical expression at 16 weeks (Fig. 3H), we further investigated the Muc5ac expression by immunofluorescence at all post-infection time points. Our data indicated that Muc5ac was lost in the gastric body as early as 4 weeks after infection, with complete loss seen by 16 weeks (Fig. 4). This decreased glycoprotein expression correlates with gastritis, but occurs prior to significant epithelial alterations such as atrophy, metaplasia, or dysplasia. Role of innate immunity in mucin alterations seen after H. felis infection We have previously shown that CD4+ T-cells are critical to the induction of gastritis, metaplasia, and dysplasia, after H. felis infection of C57BL/6 mice (McCracken et al. 2005; Roth et al. 1999). Therefore, we utilized a similar experimental system to determine the contribution of the adaptive immune system to the alterations seen in mucin and TFF expression after H. felis infection. As B6.RAG-1-/- mice are deficient in B or T cells, they are a good model to use to analyze the effects of H. felis infection in the absence of an adaptive immune system (Mombaerts et al. 1992). As previously published, at 4 and 16-weeks after H. felis infection, the B6.RAG-1-/- mice showed no significant histological alterations, while maintaining a high level of HF colonization (data not shown). Intriguingly, these mice still lose Muc5ac expression in the body as early as 4 weeks after H. felis expression, implying that the adaptive immune response is not responsible for this expression change. However, the increased expression of two 72 Muc5ac Score 3 2 1 0 B6 m ock B6 + Hf 4 wks B6 + Hf B6 + Hf * * B6 + Hf B6 + Hf B6 + Hf 8 wks 12 wks 16 wks 20 wks 24 wks Weeks Figure 4: Immunofluorescent expression of Muc5ac over the course of the infection. Muc5ac was analyzed by a semiquantative scoring system on a 0 – 3 scale. The individual scores are indicated by the circle with the horizontal line representing the median. *p < 0.05 as compared to B6 mock. 73 Muc5ac Score 3 2 1 * 0 B6 m ock RAG m ock B6 + Hf 1 wk * * RAG + Hf B6 + Hf RAG + Hf B6 + Hf RAG + Hf 1 wk 4 wks 4 wks 16 wks 16 wks Weeks muc3 muc4 * B6 B6.RAG muc5ac muc5b * 0. 12 0. 5 25 0. 5 1 2 4 8 16 32 64 12 8 25 6 51 10 2 2 20 4 4 40 8 96 TFF1 Fold Change (16 weeks) Figure 5: Comparison of mucin expression in C56BL/6 and B6.RAG-1-/- infected mice. Figure 5A is the immunofluorescence expression of Muc5ac in the B6 and B6.RAG animals over the course of the experiment. As there were no changes in the uninfected animals they are all combined. *p < 0.01 as compared to respective mocks. Figure 5B shows the RNA expression in the B6.RAG-1-/- and the B6 stomachs looking at 16 weeks of infection. *p < 0.01 as compared to respective mocks. 74 mucins, Muc4 and Muc5b, was critically dependent on the presence of an adaptive immune response. Figure 5B shows the RNA data between the B6 and B6.RAG. The expression of Muc4 and Muc5b never changes in the infection in the B6.RAG-1-/- while it changes in the B6 model. 75 DISCUSSION Many publications have shown alterations in the expressions of mucins and trefoil factors in human gastric atrophy and adenocarcinoma; however, it is unclear how our murine model of disease correlates with this information. Since C57BL/6 infection with H. felis resembles the human disease histologically, we designed experiments to examine whether mucins and trefoil factor expression would be altered in a way that resembled the human disease. The histological changes and the degree of H. felis colonization were inversely proportional in our mouse model, similar to what is seen in the human disease (Correa 1988; Karnes et al. 1991; Kikuchi 2002). As the histological scores increase (indicating an increase in both inflammation and epithelial alterations) the colonization of H. felis is decreased. Our RNA expression data demonstrates that Muc4, Muc5b, and TFF1 resemble what has been seen in biopsies of human gastric adenocarcinoma. Muc1, Muc2, Muc3, Muc5ac, TFF2, and TFF3 all had the same expression in total gastric RNA regardless of the presence or timing of infection. Although this is different than what is reported in human disease, there are at least three possible explanations. First, the mouse disease may not mimic precisely what is seen in the human disease. Second, the mice were analyzed at 24 weeks of infection (the longest time point used), and at this point the majority of them have not progressed to gastric adenocarcinoma, whereas the human literature analyzed biopsies from patients who have progressed to gastric adenocarcinoma. Finally, it is clear that there is not a direct correlation between RNA expression of mucin genes and their level of expression, as assess by immunohistochemical detection with antibodies. As mucins are complex glycoproteins, 76 their antibody epitotes are almost certainly made up of both specific amino acid sequences and the specific sugar residues attaches to this protein backbone (Brockhausen 2003; de Bolos et al. 2001). Our RNA expression data cannot evaluate any differences in glycoprotein expression secondary to alterations in glycosylation. Therefore, where murine-specific antibodies were available, we also evaluated the immunohistochemical expression of mucins. Table III correlates the changes seen in the H. felis C57BL/6 mouse model (using 24 weeks as the endpoint for comparison) as compared to the human model (based on literature) of the disease. MUC4, MUC5B, MUC5AC, TFF1 and TFF2 appear to change in similar manners in both models. MUC1 has similar expression in a normal gastric stomach but differ when expression in human biopsies are compared to our mouse model of disease. Muc2, Muc3, Muc6, and TFF3 appear to have limited expression in the normal murine stomach and these are not altered by murine H. felis infection. This is in contrast to expression patterns reported in human stomach, where MUC6 is expressed in the normal stomach and is lost during progression to gastric cancer; and TFF3 is not expressed by immunohistochemistry in the normal human stomach but is increased in intestinal metaplasia. As human gastric biopsies are usually taken as histological diagnosis of gastric adenocarcinoma, the addition of some type of immunofluorescence analysis for mucins that might predict progression to disease would be a valuable diagnostic tool. Our data clearly indicates that a loss of Muc5ac and a gain of Muc4 and Muc5b correlate with disease progression. Although similar changes in MUC4 and MUC5AC have previously 77 Table III: Comparison of Human and Murine Mucin Changes Normal Gastric Reference Normal Gastric - Adenocarcinoma Gastric Human – Human Mouse Yes Increased (Wang Yes MUC1 and Fang 2003) No Increased (Babu et Yes MUC2 al. 2006; Roessler et al. 2005) No Increased (Ho et al. Yes MUC3 1995; Wang and Fang 2003) No Increased (Ho et al. Yes MUC4 1995) No Increased (Pinto-de- Yes MUC5b Sousa et al. 2004) Yes Decreased (Babu et Yes MUC5AC al. 2006; Marques et al. 2005) Yes Decreased (Babu et Yes MUC6 al. 2006; Marques et al. 2005) Yes Decreased (Muller Yes TFF1 and Borchard 1993; Wong et al. 1999) Yes Yes (Dhar et Yes TFF2 al. 2005; Hu et al. 2003) No Yes (intestinal (Taupin et Yes TFF3 metaplasia) al. 2001) *Decreased in body of stomach by immunofluorescence. **Confirmed by immunofluorescence analysis. 78 H. felis Model (RNA-24 weeks) No change** No change Decreased** Increased** Increased No change* No change Decreased No change No change been seen in human biopsies of gastric adenocarcinoma, it is not known whether these changes precede the cancerous changes. The loss of Muc5ac has been proposed to be a key alteration in the progression to gastric adenocarcinoma. By losing a key part of the mucin layer which interacts with the trefoil factors, the tissue of the stomach may demonstrate decreased repair in response to injury and thus the gastric adenocarcinoma develops. Our data from the H. felis infected immunodeficient B6.RAG1-/- mouse would indicate that this change in Muc5ac, in the continuing presence of Helicobacter colonization, is not sufficient for adenocarcinoma formation. Some factor in the adaptive immune response is also critical to the disease progression. The effect of the adaptive immune system after infection on the expression of Muc4 and Muc5b imply that these two mucins may play a critical role in progression to gastric cancer. Since these changes occurred early in the disease process (as early as 4 weeks, data not shown) they could be explored as a early marker for lesions predisposed to progression to gastric adenocarcinoma and could potentially allow pathologists to detect precancerous lesions and allow gastroenterologists to institute early treatment. These findings strengthen the approach of using a mouse model to learn more about disease. Specifically, multiple aspects of the disease process can be manipulated, and as we know the starting point of infection, we can closely follow disease progression. If a change is evident in the model prior to progression to gastric adenocarcinoma it may lead to the development of novel treatment strategies. To date a Muc4 or Muc5b deficient mouse has not been created. Future studies could involve such models to determine if they do play a critical role in progression to gastric adenocarcinoma. 79 ACKNOWLEDGMENTS This work was supported in part by American Cancer Society Grant RPG-99-086-01MBC, the NIH grants R01 DK059911, P01 DK071176, and the University of Alabama at Birmingham Digestive Diseases Research Development Center Grant #P30 DK064400. JMS received salary support from the NIH training grant T32 AI07041. We thank Dr. Samuel Ho for the generous gift of the Muc3 and Muc4 antibodies. 80 REFERENCES Babu SD, Jayanthi V, Devaraj N, Reis CA, Devaraj H (2006) Expression profile of mucins (MUC2, MUC5AC and MUC6) in Helicobacter pylori infected pre-neoplastic and neoplastic human gastric epithelium. Mol Cancer 5:10 Bas A, Forsberg G, Hammarstrom S, Hammarstrom ML (2004) Utility of the housekeeping genes 18S rRNA, beta-actin and glyceraldehyde-3-phosphatedehydrogenase for normalization in real-time quantitative reverse transcriptasepolymerase chain reaction analysis of gene expression in human T lymphocytes. Scand J Immunol 59:566-573 Brockhausen I (2003) Glycodynamics of mucin biosynthesis in gastrointestinal tumor cells. Adv Exp Med Biol 535:163-188 Brown JK, Pemberton AD, Wright SH, Miller HR (2004) Primary antibody-Fab fragment complexes: a flexible alternative to traditional direct and indirect immunolabeling techniques. J Histochem Cytochem 52:1219-1230 Cai X, Carlson J, Stoicov C, Li H, Wang TC, Houghton J (2005) Helicobacter felis eradication restores normal architecture and inhibits gastric cancer progression in C57BL/6 mice. Gastroenterology 128:1937-1952 Chen Y, Zhao YH, Kalaslavadi TB, Hamati E, Nehrke K, Le AD, Ann DK, Wu R (2004) Genome-wide search and identification of a novel gel-forming mucin MUC19/Muc19 in glandular tissues. Am J Respir Cell Mol Biol 30:155-165 Chomczynski P, Sacchi N (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156-159 Clyne M, Dillon P, Daly S, O'Kennedy R, May FE, Westley BR, Drumm B (2004) Helicobacter pylori interacts with the human single-domain trefoil protein TFF1. Proc Natl Acad Sci U S A 101:7409-7414 Correa P (1988) A human model of gastric carcinogenesis. Cancer Res 48:3554-3560 de Bolos C, Real FX, Lopez-Ferrer A (2001) Regulation of mucin and glycoconjugate expression: from normal epithelium to gastric tumors. Front Biosci 6:D1256-1263 Dhar DK, Wang TC, Tabara H, Tonomoto Y, Maruyama R, Tachibana M, Kubota H, Nagasue N (2005) Expression of trefoil factor family members correlates with patient prognosis and neoangiogenesis. Clin Cancer Res 11:6472-6478 Escande F, Porchet N, Bernigaud A, Petitprez D, Aubert JP, Buisine MP (2004) The mouse secreted gel-forming mucin gene cluster. Biochim Biophys Acta 1676:240-250 81 Fox JG, Blanco M, Murphy JC, Taylor NS, Lee A, Kabok Z, Pappo J (1993) Local and systemic immune responses in murine Helicobacter felis active chronic gastritis. Infect Immun 61:2309-2315 Fox JG, Rogers AB, Whary MT, Ge Z, Ohtani M, Jones EK, Wang TC (2007) Accelerated progression of gastritis to dysplasia in the pyloric antrum of TFF2 -/C57BL6 x Sv129 Helicobacter pylori-infected mice. Am J Pathol 171:1520-1528 Heid CA, Stevens J, Livak KJ, Williams PM (1996) Real time quantitative PCR. Genome Res 6:986-994 Higuchi T, Orita T, Nakanishi S, Katsuya K, Watanabe H, Yamasaki Y, Waga I, Nanayama T, Yamamoto Y, Munger W, Sun HW, Falk RJ, Jennette JC, Alcorta DA, Li H, Yamamoto T, Saito Y, Nakamura M (2004) Molecular cloning, genomic structure, and expression analysis of MUC20, a novel mucin protein, up-regulated in injured kidney. J Biol Chem 279:1968-1979 Ho SB, Shekels LL, Toribara NW, Kim YS, Lyftogt C, Cherwitz DL, Niehans GA (1995) Mucin gene expression in normal, preneoplastic, and neoplastic human gastric epithelium. Cancer Res 55:2681-2690 Hoffmann W, Hauser F (1993) The P-domain or trefoil motif: a role in renewal and pathology of mucus epithelia? Trends Biochem Sci 18:239-243 Hu GY, Yu BP, Dong WG, Li MQ, Yu JP, Luo HS, Rang ZX (2003) Expression of TFF2 and Helicobacter pylori infection in carcinogenesis of gastric mucosa. World J Gastroenterol 9:910-914 Kaneko Y, Yanagihara K, Miyazaki Y, Hirakata Y, Mukae H, Tomono K, Okada Y, Kadota J, Kohno S (2003) Overproduction of MUC5AC core protein in patients with diffuse panbronchiolitis. Respiration 70:475-478 Karnes WE, Jr., Samloff IM, Siurala M, Kekki M, Sipponen P, Kim SW, Walsh JH (1991) Positive serum antibody and negative tissue staining for Helicobacter pylori in subjects with atrophic body gastritis. Gastroenterology 101:167-174 Katoh M (2003) Trefoil factors and human gastric cancer (review). Int J Mol Med 12:3-9 Kawakubo M, Ito Y, Okimura Y, Kobayashi M, Sakura K, Kasama S, Fukuda MN, Fukuda M, Katsuyama T, Nakayama J (2004) Natural antibiotic function of a human gastric mucin against Helicobacter pylori infection. Science 305:1003-1006 Kikuchi S (2002) Epidemiology of Helicobacter pylori and gastric cancer. Gastric Cancer 5:6-15 82 Kurt-Jones EA, Cao L, Sandor F, Rogers AB, Whary MT, Nambiar PR, Cerny A, Bowen G, Yan J, Takaishi S, Chi AL, Reed G, Houghton J, Fox JG, Wang TC (2007) Trefoil family factor 2 is expressed in murine gastric and immune cells and controls both gastrointestinal inflammation and systemic immune responses. Infect Immun 75:471-480 Lauren P (1965) The Two Histological Main Types Of Gastric Carcinoma: Diffuse And So-Called Intestinal-Type Carcinoma. An Attempt At A Histo-Clinical Classification. Acta Pathol Microbiol Scand 64:31-49 Lee A, Fox JG, Otto G, Murphy J (1990) A small animal model of human Helicobacter pylori active chronic gastritis. Gastroenterology 99:1315-1323 Leung WK, Sung JJ (2002) Review article: intestinal metaplasia and gastric carcinogenesis. Aliment Pharmacol Ther 16:1209-1216 Marques T, David L, Reis C, Nogueira A (2005) Topographic expression of MUC5AC and MUC6 in the gastric mucosa infected by Helicobacter pylori and in associated diseases. Pathol Res Pract 201:665-672 McCracken VJ, Martin SM, Lorenz RG (2005) The Helicobacter felis model of adoptive transfer gastritis. Immunol Res 33:183-194 Mohammadi M, Redline R, Nedrud J, Czinn S (1996) Role of the host in pathogenesis of Helicobacter-associated gastritis: H. felis infection of inbred and congenic mouse strains. Infect Immun 64:238-245 Mombaerts P, Iacomini J, Johnson RS, Herrup K, Tonegawa S, Papaioannou VE (1992) RAG-1-deficient mice have no mature B and T lymphocytes. Cell 68:869-877 Muller W, Borchard F (1993) pS2 protein in gastric carcinoma and normal gastric mucosa: association with clincopathological parameters and patient survival. J Pathol 171:263-269 Nomura S, Baxter T, Yamaguchi H, Leys C, Vartapetian AB, Fox JG, Lee JR, Wang TC, Goldenring JR (2004) Spasmolytic polypeptide expressing metaplasia to preneoplasia in H. felis-infected mice. Gastroenterology 127:582-594 Parkin DM, Bray F, Ferlay J, Pisani P (2005) Global cancer statistics, 2002. CA Cancer J Clin 55:74-108 Pinto-de-Sousa J, Reis CA, David L, Pimenta A, Cardoso-de-Oliveira M (2004) MUC5B expression in gastric carcinoma: relationship with clinico-pathological parameters and with expression of mucins MUC1, MUC2, MUC5AC and MUC6. Virchows Arch 444:224-230 83 Reis CA, David L, Nielsen PA, Clausen H, Mirgorodskaya K, Roepstorff P, SobrinhoSimoes M (1997) Immunohistochemical study of MUC5AC expression in human gastric carcinomas using a novel monoclonal antibody. Int J Cancer 74:112-121 Ringel J, Lohr M (2003) The MUC gene family: their role in diagnosis and early detection of pancreatic cancer. Mol Cancer 2:9 Roessler K, Monig SP, Schneider PM, Hanisch FG, Landsberg S, Thiele J, Holscher AH, Dienes HP, Baldus SE (2005) Co-expression of CDX2 and MUC2 in gastric carcinomas: correlations with clinico-pathological parameters and prognosis. World J Gastroenterol 11:3182-3188 Roth KA, Kapadia SB, Martin SM, Lorenz RG (1999) Cellular immune responses are essential for the development of Helicobacter felis-associated gastric pathology. J Immunol 163:1490-1497 Ruchaud-Sparagano MH, Westley BR, May FE (2004) The trefoil protein TFF1 is bound to MUC5AC in human gastric mucosa. Cell Mol Life Sci 61:1946-1954 Shirazi T, Longman RJ, Corfield AP, Probert CS (2000) Mucins and inflammatory bowel disease. Postgrad Med J 76:473-478 Taupin D, Pedersen J, Familari M, Cook G, Yeomans N, Giraud AS (2001) Augmented intestinal trefoil factor (TFF3) and loss of pS2 (TFF1) expression precedes metaplastic differentiation of gastric epithelium. Lab Invest 81:397-408 Van De Bovenkamp JH, Korteland-Van Male AM, Buller HA, Einerhand AW, Dekker J (2005) Infection with Helicobacter pylori affects all major secretory cell populations in the human antrum. Dig Dis Sci 50:1078-1086 Van den Brink GR, Tytgat KM, Van der Hulst RW, Van der Loos CM, Einerhand AW, Buller HA, Dekker J (2000) H pylori colocalises with MUC5AC in the human stomach. Gut 46:601-607 Vanagunas A (1998) The Link Between Helicobacter pylori and Gastric Cancer. Infect Med 15:644 - 650, 656 Wang RQ, Fang DC (2003) Alterations of MUC1 and MUC3 expression in gastric carcinoma: relevance to patient clinicopathological features. J Clin Pathol 56:378-384 Wong WM, Poulsom R, Wright NA (1999) Trefoil peptides. Gut 44:890-895 84 HELICOBACTER FELIS ASSOCIATED GASTRIC PATHOLOGY IN GNOTOBIOTIC MICE by JULIA M. SCHMITZ, TRENTON R. SCHOEB, THOMAS D. SOLTAU, VANCE J. MCCRACKEN, AND ROBIN G. LORENZ In preparation for submission to Journal of Immunology Format adapted for dissertation 85 ABSTRACT Human infection with Helicobacter pylori leads to multiple pathologic consequences, including the development of gastric adenocarcinoma. Although H. pylori is classified as a type-1 carcinogen, it is not clear if there are additional non-Helicobacter factors required for cancer induction. In this study we analyzed the potential role of nonHelicobacter gastric microbiota in the development of gastric pathology after H. felis of C57BL/6 mice. Two different gnotobiotic murine models were used. The first model was free of all bacteria in the system except for the added H. felis (B6.GB). The second model utilized mice colonized with the well defined Altered Schaedler Flora (B6.ASF). When these two gnotobiotic models, as well as our specific pathogen-free mice (B6.SPF) were infected with H. felis, all three models showed similar histological changes over the course of the infection, indicating that Helicobacter alone is sufficient to induce gastric pathology. However, when the colonization levels were compared, there was a significant different between the three strains. The H. felis infected B6.GB and B6.ASF mice did not clear the gastric helicobacter, while the infected B6.SPF eliminated all detectable H. felis. In order to understand the continuing inflammation in the B6.SPF stomach in the absence of pathogenic H. felis, we analyzed the gastric microbiological community by denaturing gradient gel electrophoresis. Our results indicate that additional bacteria are able to thrive in the stomach of H. felis infected B6.SPF animals, but not in the stomachs of the B6.GB or B6.SPF. These findings support the concept that there are multiple triggers of helicobacter-associated gastric inflammation, including nonhelicobacter microbiota. As the normal gastric milieu is not conductive to the growth of 86 most bacteria, these results indicated that one mechanism of helicobacter-induced gastric pathology is the alteration of the gastric environment to allow colonization by other microbiota. 87 INTRODUCTION Helicobacter pylori infection is the most common bacterial infection worldwide (1, 2). In a subset of infected individuals, infection is associated with gastric atrophy, loss of parietal cells, and chronic active gastritis (3-5). These alterations lead to a significant change in the protective mucus layer of the stomach, as well as a change towards a more neutral pH. These alterations have been proposed to allow environmental carcinogens and microbial components more direct access to the gastric epithelium causing subsequent alterations in cellular DNA and eventual gastric adenocarcinoma. Gastric adenocarcinoma is the second leading cause of cancer death and the fourth most prevalent cancer worldwide (4, 6). The study of helicobacter-associated gastric adenocarcinoma development has focused on animal models of disease, including the H. pylori infected Mongolian gerbil and the H. felis (ATCC 49179) infected C57BL/6 mouse (7-10). These models develop an intestinal type of gastric adenocarcinoma, which progresses through a series of alterations in the epithelial cells that include atrophy, metaplasia, and dysplasia with 100% of mice progressing to gastric adenocarcinoma after infection with Helicobacter felis for 12 to 15 months (5) The potential role of microbial components other than Helicobacter in this progression to gastric carcinoma has not been well studied. The mammalian body is a host to numerous microbial populations especially in the gastrointestinal tract. This microbiome exceeds the number of cells in the host by a factor of 10 (11). The stomach was previously considered to be a sterile environment due to the highly harsh acidic environment and it was thought that any bacteria found there came from ingested 88 materials or was passed down from the oral cavity (11-13). Recent studies have shown that there is a great diversity of bacteria surviving in the stomach of humans. Using broad-range PCR and 16S rDNA sequence analysis, approximately 128 phylotypes were found and were similar to what is found in the lower gastrointestinal tract (14-16). By histology and bacterial culture it was shown that stomachs of mice contain lactobacilli and Group N streptococci (17). Yamaguchi, et.al. demonstrated that specific pathogen free (SPF) C57BL/6 mice and germ-free (GF) IQI mice, when immunized with H. pylori heat shock protein 60 and then infected with H. pylori 1402, only developed post-immunization gastritis in the presence of bacterial flora (18). Two studies have investigated the effect of H. pylori infection on the gastric microbial ecosystem. Aebischer et.al. utilized clone libraries of gastric16S rRNA genes to analyze the composition of the gastric microbiota in BALB/c mice infected with H. pylori (strain P76) for 8 weeks. It was determined that that in noninfected mice lactobacilli dominated the gastric microbiota, while the infected stomachs were colonized with Clostridia, Bacteroides/Prevotella spp., Eubacterium spp., Ruminococcus spp., Streptococci, and E. coli, all of which are bacteria that are normally located in the lower intestinal tract, showing that H. pylori could be enabling gut bacteria to adapt to gastric conditions (19). In contrast to this report, Tan, et.al. has reported that the gastric microbiota did not change over the six months after infection of C57BL/6 mice with H. pylori (strain SS1) (2). The dominant gastric species in their studies were Lactobacillus reuteri and L. murinus. One drawback to these studies is that they only evaluated alterations in gastric microbiota after murine infection with H. pylori. As it is clear that this human pathogen 89 does not cause significant gastric pathology in mice, these studies do not critically test the role of non-helicobacter microbiota on the induction of gastritis and subsequent gastric epithelial alterations. It has been shown that H. felis (strain CS1) can infect Germ-free (GF) Swiss Webster mice for up to eight-weeks and cause a progression from acute inflammation to active chronic inflammation, as seen in human infection (20). However, only one study has investigated the long-term contribution of the microbiological community after H. felis infection, which has been shown to induce gastric pathology and gastric adenocarcinoma in C57BL/6 mice (5). Fox et.al infected outbred Swiss Webster GF mice with H. felis for 50 weeks. These mice developed a chronic gastritis, however since there were no „normal‟ SPF mice included in this study, the influence of commensal gastric microbiota was not studied (21). In order to critically test the role of non-Helicobacter gastric bacteria in the gastritis and subsequent gastric dysplasia associated with H. felis infection we infected germfree C57BL/6 mice (22). These mice, which have an absence of any type of additional bacteria, will determine if H. felis alone (along with the immune response it initiates) is sufficient to cause the gastric alterations seen after infection, or if the Helicobacter infection also alters the gastric microbiological environment and if this alteration is important in gastric pathology. While mice colonized with only H. felis are a critical test of the role of the role of other microbiota in gastric pathology, this is clearly a very artificial environment. In order to more closely mimic the normal gastric environment, while still controlling the microbiological exposure, we utilized a specific gnotobiotic model that has been colonized with Altered Schaedler Flora (ASF) (23). These mice are generated by 90 colonizing GF mice with a cocktail of eight known bacterial strains, therefore allowing for a standardized microflora to be investigated. The ASF contains Clostridium sp. (ASF356), Lactobacillus sp. (ASF360), Lactobacillus murinus (ASF361), Flexistipes group (ASF457), Eubacterium plexicaudatum (ASF492), low G + C content gram positive group (ASF500), Clostridum sp. (ASF502), and Bacteroides sp (ASF519). (2325). In a study that analyzed the spatial distribution of the ASF throughout the gastrointestinal tract of recently colonized C.B-17 SCID mice, it was shown that approximately 1.59 x 106 bacteria/gram were found in the glandular stomach, with 50% of the bacteria in the stomach being identified as Lactobacillus murinus (24). We utilized these controlled microbial mice to investigate the effect of ASF bacteria on the histological, immunological, and epithelial changes that occur after H. felis infection of C57BL/6 mice. 91 MATERIALS AND METHODS Mice Three inbred mouse strains between 6 and 10 weeks of age at the time of initial infection were used in this study. All animals were female, except for gnotobiotic animals and their B6 controls at the 16 week time-point which contained a mix of males and females. C57BL/6J specific pathogen free (B6.SPF) mice were obtained from The Jackson Labs, Bar Harbor, ME and housed in ventilated rack. The detailed list of our facility‟s SPF conditions can be accessed at http://main.uab.edu/sites/ComparativePathology/surveillance/. B6.SJL-Ptprca Pepcb/BoyJ (gnotobiotic; B6.GB) and B6.SJL-Ptprca Pepcb/BoyJ (Altered Schaedler Flora; B6.ASF) were maintained in Trexler-type (Standard Safety Equipment Co., Palatine, IL) or semirigid isolators (Park Bioservices, Groveland, MA) according to standard gnotobiotic methods (26). All mice were raised on autoclaved standard laboratory mouse chow (NIH31, Harlan Teklad, Madison, WI) and filter sterilized autoclaved water ad lib and housed in a facility that maintained a 12:12-hr light-dark schedule. Germfree status was monitored by monthly aerobic and anaerobic cultures of fecal and water samples and by examination of gram stained fecal specimens. Colonization with ASF organisms was monitored initially by examination of gram stained fecal specimens for each bacterial morphologic type (27, 28). All animal protocols and procedures were conducted in accordance with the Institution Animal Care and Use Committee at the University of Alabama at Birmingham (Birmingham, AL). 92 H. felis infections The three different strains of mice, B6.SPF, B6.GB, and B6.ASF, were mockinfected or H. felis infected as described previously (8). Briefly, the mice were orally infected on days 1, 4, and 7 with 5 X 107 CFU H. felis (ATCC 49179) with 25 L in brain-heart infusion broth (BHI)/glycerol. This infection protocol results in 100% efficiency in our laboratory. The mock infected mice received sterile BHI/glycerol without bacteria. Tissue Preparation Sacrifice of the mice was performed using isofluorane inhalation followed by cervical dislocation. Immediately following sacrifice, the stomach was removed and quartered. One quarter was immersed in RNALater (Ambion; Austin, TX) for RNA isolation and one quarter was immersion fixed in Carnoy‟s solution (6:3:1 of 100% ethanol, chloroform, and glacial acetic acid) for 4 hours at 4oC, than changed to ethanol, and placed in cassettes for embedding in paraffin. The tissue was cut into five-micron sections on a microtome and attached to pre-cleaned microscope slides (Snowcoat X-tra, Surgipath; Richmond, IL). A third quarter was snap frozen in liquid nitrogen and stored at -80oC until ready for DNA isolation for Denaturing Gradient Gel Electrophoresis (DGGE) analysis. The last quarter was immediately homogenized in a solution of 500mM NaCl/ 50mM Hepes containing 0.1% Triton, 0.02% NaN3, and mammalian protease inhibitor (Sigma, St. Louis, MO) at a pH of 7.4 for protein analysis (29). The solution is then frozen overnight, followed by centrifugation at 6,000 RPM for 20 minutes. 93 Total RNA was isolated from the quarter stomach using the phenol and guanidine isothiocyanate method with Trizol® (Invitrogen; Carlsbad, CA) (30). The total RNA was processed through a genomic DNA clean-up step utilizing the Turbo DNase kit (Ambion, Austin, TX). cDNA was made with equal amounts of mRNA (2 g), using the Roche Trasncriptor First Strand cDNA Synthesis Kit (Roche, Pensberg, Germany). Using Applied Biosystems Assays-On-Demand primer/probe sets (Table 1) and TaqMan Universal PCR Mix (PE Applied Biosystems, Foster City, CA), quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) was performed on the MX3000P real-time PCR machine (Stratagene, La Jolla, CA). Data was analyzed by the “delta-delta Ct” relative quantitation method as described in Applied Biosystems manufactor‟s instructions (4371095 Rev A, PE Applied Biosystems; Foster City, CA). In short, the average crossing threshold of each target gene is subtracted from the average crossing threshold of the housekeeping gene (18S) to determine the relative expression (Ct). To determine the Ct the average Ct of the experimental animals (Helicobacter-infected) is subtracted from the average control (mock-infected) Ct for each gene and set of animals. The Ct is then used in the formula 2Ct to determine the fold change in mRNA expression. To determine the upper and lower limits of fold change the standard deviation of the average of each experimental group was taken through the above calculations (31, 32). Scoring of Histology and H. felis colonization Tissue sections of the stomach were stained with Hematoxin and Eosin and graded by two scientists blinded to the experimental groups (RGL and JMS). The 94 Table 1: Primer-Probe pairs utilized for qRT-PCR Gene Applied Biosystems Exons of probes Gene ID Catalogue Number* 18S – housekeeping Hs99999901_s1 None LOC100008588 gene Muc5ac Mm01276725_g1 33 – 34 mCG142254 TFF1 Mm00436945_m1 1-2 mCG14583 ATPase Mm00444423_m1 18 - 19 mCG22783 IF Mm00433596_m1 5–6 mCG12895 Pep Mm00482488_m1 5–6 mCG15560 TSLP Mm00498739_m1 4–5 mCG119968 CXCL15 Mm00441263_m1 1–2 mCG1706 LIX Mm00436451_g1 1–2 mCG1701 KC Mm00433859_m1 3–4 mCG1708 MIP2 Mm00436450_m1 3–4 mCG1710 Mm00801778_m1 1–2 mCG1237 IFN IL-17 Mm00439619_m1 2–3 mCG7914 IL-10 Mm00439616_m1 3–4 mCG2645 Mm00441724_m1 1–2 mCG7649 TGF FoxP3 Mm00475156_m1 1–2 mCG3948 IL-6 Mm00446190_m1 2–3 mCG11634 Mm00443258_m1 1 – 2 mCG15911 TNF Mm00434228_m1 3–4 mCG20999 IL-1 MPO Mm00447886_m1 13 – 14 mCG119373 *All genes were purchased from Applied Biosystems (Foster City, CA). 95 histological score can range from 0 to 9 (0 – no inflammation and no epithelial changes; 9 – severe inflammation and epithelial changes) with subscores of 0 to 3 for each of the following three areas: longitudinal extent of inflammation, vertical extent of inflammation, and histological changes. To semi-quantitate the level of H. felis gastric colonization, each stomach section was stained with rabbit anti-H. pylori antibody (SIG-3431, use at full concentration, Covance, Emeryville, CA). Studies were done in our lab to determine that it does crossreact with H. felis (unpublished data). Briefly, the stomach sections were depariffinized with Citrosolv (Fisher Scientific, Pittsburgh, PA) and isopropanol. The sections are then rehydrated with phosphate buffered saline (PBS) and pretreated with 0.25% pepsin in PBS for 10 minutes at room temperature. PBS-blocking buffer (1% bovine serum albumin and 0.3% Triton) was added to the slides to block non-specific binding proteins and to permeabilize the cell. After the blocking step, the slides were incubated with antiHelicobacter antibody for one hour at room temperature followed by a wash in PBS. For visual detection the slides were incubated with Cy3 donkey anti-rabbit (711-165-152; 6 g/mL, use at 1:250 dilution; Jackson Immunoresearch, West Grove, PA) for one hour. Finally for visualization of the nuclei the sections were counterstained with Hoechst 33258 (09460; 2 g/mL, use at 1:2000 dilution; Sigma, St. Louis, MO). Scoring was as described above, scoring both the antrum and esophageal junction on a 0 to 4 scale; 0 = no bacteria per gland, 1 = 1 – 2 bacteria per gland, 2 = 3 – 10 bacteria per gland, 3 = 11 – 20 bacteria per gland, and 4 = >20 bacteria per gland. The scores for each section were averaged between the two scorers. The averages of the sections are then graphed. 96 Scoring of Muc5ac by immunofluorescene To access the expression of Muc5ac, stomach sections were stained using a “mouse on mouse” protocol (33). The sections were deparaffinized, rehydrated, and blocked as described above. The primary antibody (mouse monoclonal IgG1 antiMuc5ac (clone 45M1); 200g/mL, MS-145-PO, Thermo Scientific, Fremont, CA) and secondary detection antibody (Cy3 Fab Goat anti Mouse; 115-167-003; Jackson Immunoresearch; West Grove, PA) are incubated together at a 1:2 ratio (w/w) for 40 minutes at room temperature in triton-free PBS-BB. Excess mouse serum was added to the antibody mixture for 10 minutes to block unbound Fab fragments, after which the solution was diluted to 1:100 (final) and placed on the slide. The slides were scored on a 0 – 3 scale; with 0 = no staining and 3 = bright staining. Each stomach section was scored in two areas – body and antrum. The antral scores were utilized as a positive control, as Helicobacter infection only effects expression of Muc5ac in the body of the stomach. Only stomach sections that received a score of 2 or 3 in the antrum were used for further analysis. Extraction of DNA from Stomachs One-quarter of mouse stomachs were flash frozen in liquid nitrogen and then stored at -80 C. DNA extraction from luminal bacteria was performed using four washes of 0.1% Tween (Fisher Biotech) in Phosphate Buffered Saline (Mediatech). The stomach was combined with 5 ml of this solution and vortexed for 30 seconds. The wash solution was collected leaving the tissue behind. The collected washes were centrifuged at 5000 97 RPM for 15 minutes. The pellet was resuspended in tris/EDTA (TE, pH 8.0 Ambion) and tris saturated phenol and combined with 200 L of 0.1 mm glass beads. This solution was shaken for two 15 minute episodes with 5 minute in an ice bath following each episode. This solution was centrifuged for 5 minutes at 11000 rpm. Phenol chloroform (PC) was used to extract DNA. Two successive PC extractions were performed, with centrifugation at 11000 RPM x 5 minutes between steps, removing the top layer for the next step. After the second PC extraction the supernatant was combined with sodium acetate and 100% ethanol. This was allowed to sit on ice for 5 minutes to allow precipitation of DNA. This was centrifuged at 11000 RPM for five minutes. The pellet was washed with 70% ethanol and centrifuged again. The pellet was then resuspended in TE. PCR of Gastric Washes DNA samples were exposed to polymerase chain reaction (PCR) to replicate 16S ribosomal DNA. A master mix of 5 L/sample 10X buffer (Takara Bio inc), 4 L/sample deoxyribonucleic acid nucleotides (Takara Bio inc), 0.25 L/sample Hotstart Taq polymerase (Takara Bio inc), sterile water 8.75 L/sample, and 1 L/sample of both forward and reverse primers was prepared (20 L/sample). The forward primer used was 5‟CGCCCGCCGCGCGCGGCGGGCGGGGGGGGCACGGGGGGCCTACG GGAGGCAGCAG 3‟ (Sigma). The reverse primer used was 5‟ATTACCGCGGCTGCT GG 3‟(Sigma). The master mix was combined with 150 nanograms of DNA and water to make a total reaction volume of 50 L. This was then exposed to the following PCR conditions utilizing a Perkins-Elmer Gene Amp PCR System 2400. Initial denaturation of 95 C for 5 min followed by: 20 cycles of 95 C for 1 min, an annealing step for 45 sec, 98 and 72 C for 1 min. Initial annealing temperature was 65 C, this was ramped down 0.5 C per cycle over the 20 cycles. Following the 20 cycles, 10 additional cycles of 95 C for 1 minute, 55 C for 45 seconds, and 72 C for 1 minute were performed. A final step of 72 C for 5 minutes was performed and the samples were stored at -20 C. Denaturing Gradient Gel Electrophoresis of Gastric Washes A Bio-Rad DCode system (Bio-Rad Laboratories) was used to perform DGGE. Stock solutions of 35% (20 mL 40% acrylamide, 2 mL of 50x TAE, 14.7 g urea, 14 mL of deionized formamide, and deionized water to make total volume of 100mL) and 60% (20 mL 40% acrylamide, 2 mL of 50x TAE, 25.2 g urea, 24 mL of deionized formamide, and deionized water to make total volume of 100mL) were made. Right before pouring the gels 16 L of Temed (tetra-methyl-ethylenediamine, Bio-Rad laboratories) and 100 microliters of 0.1 gram/mL ammonium persulfate (Bio-Rad laboratories) were added to 16 mL of each of the stock solutions. The gradient was made with Bio-Rad Gradient Delivery System (Model 475, Bio-Rad Laboratories). After 2 hours of polymerization, the gel was loaded with a combination of 25 L of the PCR product and 25 L of loading buffer. Gels were ran overnight at 58 C and 60 volts. The gel was stained with ethidium bromide (Bio-Rad Laboratories) and visualized and imaged under ultraviolet light. Serum and Fecal Collection Whole blood was collected immediately upon sacrifice by cardiac puncture. Blood was allowed to clot for one hour and serum was separated by centrifugation at 13000 RPM. The sera samples were stored at -20oC until assays were preformed. 99 During the sacrifice of the animals, fresh fecal samples were collected. A solution of PBS supplemented with 0.05% NaN3 and mammalian protease inhibitor (10 L/mL, Sigma, St. Louis, MO) was added to the feces at a concentration of 10 L/mg of feces. The solution and feces were vortexed and then frozen overnight at -20oC. The frozen solution was allowed to thaw on ice and was then vortexed for 10 minutes followed by centrifugation at 13000 RPM. The supernatants from this spin are stored at –20oC until further analysis. Preparation of H.felis Antigen The organisms were harvested as described for inoculation, washed in PBS, and sonicated on ice for 30 seconds, with 30 seconds cooling for a total of 4 minutes using setting 4 on Branson Sonifer 250 (Branson Ultrasonics, Danbury, CT). The bacterial suspension was centrifuged at 20,000 x g at 4oC for 20 minutes. The supernatant was passed through a 0.22 m filter and supernatants were frozen at -80oC until further use. Total protein concentration was determined by the DC Protein Assay (Bio-Rad, Hercules, CA). Analysis of Total and H. felis-Specific and Serum and Fecal Antibodies ELISAs were performed to determine the specific antibody response to H. felis in both fecal and serum samples. In brief, a 96-well Immunlon Assay Plate (Fisher Scientific, Pittsburgh, PA) was coated with H. felis sonicate (10 g/mL in PBS) overnight at 4oC. Plates were washed 5 times with PBS with 0.05% Tween and nonspecific binding sites were blocked with 5% Bovine Serum Albumin (Fisher Scientific, Pittsburgh, PA) in 100 PBS for one hour at room temperature (RT). The plate was washed as before and then samples diluted in 1% BSA in PBS were incubated for two hours at room temperature. After a wash of five cycles, alkaline phosphatase-linked goat anti-mouse IgG or IgA were diluted 1:2000 in 1% BSA in PBS was added to the wells and incubated for 2 hours at RT (IgG, Cat. #1030-04; IgA, Cat. #1040-04, Southern Biotech; Birmingham, AL). The plate was washed another five times, and then the bound secondary antibody was detected using pNPP substrate solution (N-2770, Sigma, St. Louis, MO). The plates were read on a VERSAmax microplate reader (Molecular Devices, Sunnyvale, CA) at 405 nm. To determine the concentration of IgA or IgG anti-H. felis, a standard curve of the corresponding Ig (5300-01; Southern Biotech, Birmingham, AL) was run on each plate as described above with the exception of coating the plate with 10g/mL goat anti-mouse Ig (#1010-01, Southern Biotech, Birmingham, AL). For analysis of total antibody response the protocol for H. felis specific ELISA was followed with the substitution that the initial coating antibody was 10g/mL goat anti-mouse Ig (instead of H. felis sonicate). Graphic and Statistical Analysis All graphs were made using GraphPad Prism 4® (San Diego, CA). All qRT-PCR graphs are horizontal with the y-axis set at one to represent the baseline expression for each gene for each set of animals. The infected animals are always compared back to their own mock controls. The mean and range is represented in the graph. Statistics on continuous data was performed using the unpaired t-test in GraphPad InStat 3® (San 101 Diego, CA). Statistics on non-continuous data was performed with the Mann Whitney U test. Statistical significance is indicated by an * with a p<0.05. 102 RESULTS Gastric Histology and Colonization after H. felis Infection. B6.SPF, B6.GB, and B6.ASF animals were infected for 8, 16, and 24 weeks with H. felis. At all time points, the mock-infected stomachs of all three animal models have a normal stomach architecture, with parietal and zymogenic cells evident and no inflammation present (Fig. 1, Panels A, C, and E, 24 week time point shown). After 24 weeks of H. felis infection, the overall gastric histology appears similar between the B6.SPF, B6.GB, and B6.ASF animals, with a loss of parietal and zymogenic cells, gastric dysplasia, and increased inflammatory infiltrate (Fig. 1, Panels B, D, and F). The histological scores for the mock-infected models over time were all similar to unmanipulated controls (data not shown), while the majority of H. felis infected mice showed maximal inflammation and epithelial alterations by 8 weeks after infection (Fig. 1, Panels G, I, and K; individual scores with horizontal line at median for B6.SPF, B6.GB, and B6.ASF). The B6.SPF maintains this maximal histological score over 24 weeks of infection, while the histological scores are slightly decreased over time in the infected B6.ASF stomachs. The B6.GB median histological score is initially lower than the B6.SPF or B6.ASF mice, and does not change over the length of the experiment. Our previously published results have indicated that in the B6 mouse strain inflammation is inversely correlated to H. felis colonization (8). Therefore, we evaluated the level of gastric colonization in all three mouse models (Fig. 1, Panels H, J, and L; individual scores with horizontal line at median for B6.SPF, B6.GB, and B6.ASF). Mock-infected animals showed no measurable colonization (data not shown). As 103 A B C D E F 104 B6.SPF Hf 8 wks B6.SPF Hf 16 wks G Histological Score * Hf Colonization Score * * 3 2 * 1 0 B6.SPF Hf 24 wks H B6.SPF Hf 8 wks B6.SPF Hf 16 wks Animals * * Animals * * 3 * 2 * 1 0 I B6.GB Hf 8 wks B6.GB Hf 16 wks B6.GB Hf 24 wks J B6.GB Hf 8 wks B6.GB Hf 16 wks * K * 4 * * Hf Colonization Score 9 8 7 6 5 4 3 2 1 0 B6.GB Hf 24 wks Animals Animals Histological Score B6.SPF Hf 24 wks 4 9 8 7 6 5 4 3 2 1 0 Hf Colonization Score Histological Score 4 9 8 7 6 5 4 3 2 1 0 * 3 2 * 1 0 B6.ASF Hf 8 wks B6.ASF Hf 16 wks B6.ASF Hf 24 wks L Animals B6.ASF Hf 8 wks B6.ASF Hf 16 wks B6.ASF Hf 24 wks Animals Figure 1: Disease progression in B6.SPF, B6.GB, and B6.ASF stomachs after H. felis infection. Panels A, C, and E are representative images of 24 week mock-infected B6.SPF, B6.GB, and B6.ASF respectively. Panels B, D, and F are 24 week H. felisinfected B6.SPF, B6.GB, and B6.ASF animals. Bar = 50 microns. Panels G, I, and K show the histological scores over the course of the experiment. Mock-infected mice has scores similar to unmanipulated control mice. The circles represent the individual scores for each animal with the horizontal line set at the mean for the data set. Panels H, J, and K are the HF colonization scores for the three different animal groups. No colonization was noted in mock-infected controls. *p < 0.05 as compared to respective mocks. 105 expected the B6.SPF gastric H. felis colonization was decreased by 8 weeks, a time point where inflammation and gastric epithelial alterations were maximal (Fig. 1, Panels G & H). In contrast, although the histological score remains relatively high in the infected B6.ASF, the colonization scores increase over the course of the experiment (Fig. 1, Panel L). The colonization levels are maintained at a mid-level in the B6.GB infected stomachs. This data implies that the continuing stimulation for gastric inflammation must be different between the three models, as the B6.GB and B6.ASF continue to be exposed to H. felis during the entire course of the infection, whereas the B6.SPF are not. Non-Helicobacter Gastric Bacteria To test if H. felis infection induces an alteration in the gastric ecological niche and a subsequent change in colonization with other bacteria, DGGE was performed on DNA isolated from gastric washes from the three animal models during the course of the experiment. As shown in Figure 2A, the B6.SPF H. felis infected stomachs demonstrate additional bacterial bands that are not present in the B6.SPF mock animals, indicating that gastric colonization with H. felis alters the gastric environment in a way that allows other bacteria to colonize the stomach. These bacterial bands are not found in the H. felis infected B6.ASF stomachs indicating that none of the eight ASF strains correspond to these bacteria bands. This pattern is maintained at 24 weeks of infection (Fig. 2B); however now the level of H. felis colonization is high enough (>1%) to be visualized on the DGGE gel. This confirmed the increased colonization seen in Fig. 1L. DGGE analysis was also preformed on the gastric washes of the B6.GB animals to verify their germ-free status (data not shown). 106 B6.SPF B6.SPF B6.ASF B6.ASF mock Hf mock Hf B6.SPF B6.SPF B6.ASF B6.ASF mock Hf mock Hf Hf A Hf B Figure 2: DGGE on gastric washes from B6.SPF and B6.ASF infected animals. Panel A are mock- or H. felis- infected for 8 weeks, whereas Panel B are mock- or H. felisinfected for 24 weeks. As an internal positive control DNA was isolated from a culture of H. felis to show where the bacteria would band, indicated by the arrows. The H. felis infected animals also have a band at the same length down the gel as the H. felis. Notice the additional bacteria in the B6.SPF H. felis infected animals that are not in the B6.SPF mock infected animals, as indicated by the circles. 107 Expression of Muc5ac Mucins are a gel-like substance that covers the mammalian gastric, as well as other epithelial surfaces (34, 35). One key mucin, Muc5ac, has been shown to be an adherence factor for H. pylori (36, 37) and has been demonstrated to have decreased expression in stomachs afflicted with gastric adenocarcinoma (38, 39). We analyzed the expression Muc5ac in the three animal models by immunohistochemistry and by qRTPCR expression. Figure 3A shows the expression of Muc5ac by immunhistochemistry as assessed by a semi-quantative scoring system. The expression of Muc5ac in the three mock-infected animal groups was similar to normal C57BL/6 mice, while the H. felis infected animals showed a decrease in expression in all three models. This demonstrates that the level of Muc5ac expression is not the mechanism for the difference of colonization levels seen in the three animal models. This data was confirmed with the qRT-PCR data that showed that Muc5ac expression was similarly decreased in all three animal models. Total and H. felis Specific Antibody Responses in the Serum and Feces Total and H. felis specific antibody responses were assayed in the three mock- and H. felis-infected animal models. As shown in Figure 4A and C, there was no significant difference in the amount of total serum IgA and total fecal IgA in any of the animal models over time. The H. felis-specific serum IgA was similar during the course of the infection (Fig. 4B), however, the H. felis-specific fecal IgA was decreased in the B6.GB 108 Muc5ac Score 3 2 * 1 0 B6.SPF mock B6.SPF Hf 24 wks B6.GB mock B6.GB B6.ASF Hf 24 wks mock B6.ASF Hf 24 wks Animals A B 8 4 2 1 9. 8× 2. 10 -04 0× 1 3. 0 -03 9× 1 7. 0 -03 8× 1 0. 0 -03 01 56 0. 25 03 12 0. 5 06 25 0. 12 5 0. 25 0. 5 B6.SPF B6.GB B6.ASF Fold Change (24 weeks) Figure 3: Muc5ac expression after H. felis infection. Panel A is muc5ac expression as assessed by immunofluorescence using a 3 point scale for intensity of staining. The circles represent the individual scores of the animals with the horizontal line at the mean for the scores for each animal group. Panel B shows the expression of muc5ac by qRTPCR in the three animal groups. The animals are compared back their respective mockinfected controls whose expression is set to equal one. The mean and range for each experimental group at 24 weeks of infection are shown. * p < 0.05 as compared to respective mocks. 109 Serum SerumIgA IgAanti antiHfHf Total Serum IgA 45 45 40 40 B6.SPF B6.GB B6.ASF B6.SPF B6.SPF B6.GB B6.GB B6.ASF B6.ASF 30 30 ng/mL 25 25 20 20 15 15 10 10 5 5 0 0 8 weeks A 35 35 ng/mL ng/mL 6500 6000 5500 5000 4500 4000 3500 3000 2500 2000 1500 1000 500 0 16 weeks B 24 weeks ND ND ND ND 88weeks weeks 16 16 weeks weeks Weeks infected with H. felis Total Fecal IgA Fecal IgA anti Hf 55000 150 * 50000 125 45000 35000 30000 25000 B6.SPF B6.GB B6.ASF 100 ng/mL B6.SPF B6.GB B6.ASF 40000 ng/mL 24 weeks weeks 24 Weeks H. felis felis Weeksinfected infectedwith with H. 20000 75 50 15000 10000 25 5000 ND 0 C 0 8 weeks 16 weeks 24 weeks D Weeks infected with H. felis 8 weeks 16 weeks 24 weeks Weeks infected with H. felis Figure 4: Total and H. felis-specific antibody responses after H. felis infection. Panel A is total serum IgA as measured by murine IgA ELISA. Panel B is H. felis specific serum IgA. Panel C is total fecal IgA and Panel D is H. felis specific fecal IgA. The mean and standard error are shown. ND = none detected. * p < 0.05. 110 and B6.ASF as compared to B6.SPF, implying that no Helicobacter specific secretory IgA was produced in these models. Immune Response The immune response is a key factor in the inflammation that occurs in the H. felis infection. Previous data has shown that H.felis is a Th-1 mediated disease (40, 41). We analyzed the immune response in the animals at 16 and 24 weeks (Table II; epithelial genes; Table III; immune cytokines; average fold change with +/- range). Figure 5A shows the expression of IFN, a characteristic Th1 cytokine, at 24 weeks in the three animal models. The expression level is similar between the animals, showing that even without the clearance of H. felis the expression of this is not altered. Figure 5B shows the expression of IL-17, in the three animal groups at 24 weeks of infection. The B6.GB was significantly increased as compared to the B6.SPF and B6.ASF. The expression of Foxp3 is shown in Figure 5C. The B6.SPF and B6.GB are increased in expression where the B6.ASF maintained the same level of expression as the mock B6.ASF mice. 111 Table II: Average Fold Change and +/- Range of Epithelial Genes Gene B6.SPF B6.GB B6.ASF B6.SPF B6.GB 16 wks 16 wks 16 wks 24 wks 24 wks Muc5ac 0.183 0.366868 0.381 0.133 0.646 (0.0213 – (0.031 – (0.071 – (0.013 – (0.084 – 1.57) 4.3305) 2.054) 1.318) 4.99) TFF1 0.29097 0.50581 0.31 0.398 1.1647 (0.0241 – (0.0311 – (0.08 – (0.0549 (0.269 – 1.8257) 8.23) 1.177) – 2.879) 5.034) ATPase 0.1048 0.0528 0.038 0.253 0.6685 (0.0082 – (0.0066 – (0.007 – (0.0272 (0.131 – 1.342) 0.425) 0.207) – 2.363) 3.41) IF 0.2797 0.00878 0.069 0.165 2.21 (0.0255 – (0.0014 – (0.0095 (0.022 – (0.305 – 3.0667) 0.0563) – 0.5) 1.224) 15.98) Pep 0.0254 0.002637 0.005524 0.042 0.113 (0.3113 – (0.00034 (0.00077 (0.0049 (0.011 – 0.0021) – 1.9) – 0.04) – 0.349) 1.186) TSLP 0.5636 0.0266 0.2253 0.736 2.147 (0.0622 – (0.00162 (0.038 – (0.118 – (0.262 – 5.1013) – 0.4378) 1.33) 4.595) 17.6) CXCL15 10.895 55.20269 7.18 11.6 122.7 (1.2998 – (8.1063 – (1.511 – (1.348 – (23.77 – 90.81383) 375.9187) 34.126) 99.84) 633.36) LIX 120.82 2.7 3.02 45.79 390.7 (7.872 – (0.329 – (0.0687 (3.44 – (56.65 – 1854.2) 22.15) – 608.83) 2694.7) 132.84) KC 25.578 0.396 0.863 62.27 37.4 (3.0056 – (0.03 – (0.155 – (7.6 – (6.43 – 217.66) 5.13) 4.82) 509.67) 217.67) MIP2 8.8078 0.572 3.586 14.859 115.96 (0.9052 – (0.041 – (0.475 – (2.08 – (18.58 – 85.704) 8.062) 27.07) 106.14) 723.64) 112 B6.ASF 24 wks 0.0514 (0.0017 – 1.532) 0.683 (0.0804 – 5.8) 0.172 (0.0087 – 3.394) 0.525 (0.06 – 4.58) 0.06 (0.00459 – 0.8) 4.1 (0.427 – 39.136) 7.5 (0.697 – 80.744) 17.939 (1.72 – 187.12) 23.75 (2.13 – 264.72) 7.835 (0.95 – 64.517) Table III: Average Fold Change and +/- Range of Immune Response Gene B6.SPF B6.GB B6.ASF B6.SPF B6.GB 16 wks 16 wks 16 wks 24 wks 24 wks 23.907 1057.665 13.33 25.59 248.82 IFN (1.9801 – (76.439 – (1.45 – (1.037 – (22.078 – 288.64) 14634.62) 122.17) 631.59) 2804.362) IL-17 40.264 21.9072 40.8 30.1 3010.94 (4.9986 – (3.9387 – (7.098 – (3.477 – (774.9 – 324.33) 121.874) 234.63) 260.59) 11699.28) IL-10 1.991 4.4178 1.46 1.748 12.0587 (0.3272 – (1.3156 – (0.439 – (0.2858 – (2.857 – 12.114) 14.835) 4.88) 10.69) 50.893) 3.8475 0.023 1.84 3.187 31.56 TGF (0.1957 – (0.00055 – (0.259 – (0.2534 – (3.277 – 75.641) 0.974) 13.1) 40.04) 303.92) Foxp3 5.1321 0.302 1.91 47.88 12.7 (0.5695 – (0.0299 – (0.29 – (4.81 – (1.35 – 46.245) 3.05) 12.58) 476.82) 119.44) IL-6 1.8098 2.3187 2.22 0.685 10.33 (0.2054 – (0.2969 – (0.5 – (0.056 – (2.625 – 15.95) 18.10756) 10.02) 8.35) 40.66) 7.0693 6.7583 7.556 15.41 42.518 TNF (0.9439 – (0.8979 – (1.783 – (2.15 – (5.685 – 52.946) 50.8668) 32.017) 110.41) 317.97) 3.1026 0.327 4.732 8.834 66.718 IL-1 (0.244 – (0.043 – (0.669 – (1.47 – (9.9 – 39.454) 2.5) 33.478) 52.96) 449.82) MPO 1.216 0.104 1.0389 0.8197 4.377 (0.1836 – (0.0106 – (0.135 – (0.1396 – (0.448 – 8.0563) 1.034) 8.011) 4.8124) 42.74) 113 B6.ASF 24 wks 24.125 (3.71 – 156.785) 3.122 (0.438 – 22.24) 7.185 (0.734 – 70.327) 1.52 (0.14 – 16.5) 0.883 (0.088 – 8.816) 1.93 (0.1719 – 21.70) 10 (1.28 – 78.14) 18.48 (2.377 – 143.59) 2.8979 (0.37 – 22.636) B6.SPF B6.GB 64 12 8 25 6 51 2 10 24 20 48 40 96 81 9 16 2 38 4 A 32 8 16 4 2 1 0. 5 B6.ASF Fold Change (IFN) 24 weeks B6.SPF B6.ASF 32 64 12 8 25 6 51 2 10 24 20 48 40 96 81 9 16 2 38 4 8 16 4 2 1 0. 25 0. 5 * B6.GB Fold Change (IL-17) 24 weeks B B6.SPF B6.GB C 51 2 25 6 12 8 64 32 16 8 4 2 1 0. 5 0. 06 25 0. 12 5 0. 25 B6.ASF Fold Change (Foxp3) 24 weeks Figure 5: Immune response after H. felis infection in three different animal models. Panel A (IFN), B (IL-17), and C (Foxp3) is the expression of their respective genes at 24 weeks. The expression of IL-17 was significant in the B6.GB as compared to the other two infected animal groups. *p < 0.001. 114 DISCUSSION Our studies show that all three animal models (B6.SPF, B6.GB, B6.ASF) have similar histological changes after H. felis gastric infection, demonstrating that H. felis alone is sufficient to induce chronic gastritis, parietal and zymogenic cell loss, and gastric dysplasia. However, the mechanisms that induce this final common pathway of inflammation and gastric pathology appear to be different between the three models. One potential mechanism is that the B6.GB and B6.ASF did not clear the H. felis infection while the B6.SPF can clear the organisms. Therefore, these two animal models are being continuously stimulated by H. felis throughout the infection, while the stimulus of the continued inflammation in the B6.SPF may be through alternative bacteria. DGGE analysis indicated that over time there are additional bacteria now colonizing the B6.SPF stomachs that have been infected for 8, 16, or 24 weeks. It is known that the pH of the stomach becomes more neutral with H. felis infection thus allowing bacteria that could not normally thrive in the stomach to live there (12, 13). Similar bands were not seen in the B6.ASF animals, leading us to conclude that it is not one of these eight bacteria strains that are now colonizing the stomachs. It is currently unknown if these additional gastric bacteria in the B6.SPF stomachs out-compete the H. felis for its niche in the stomach or an alternative mechanism is involved. One alternative mechanism could be loss or continued presence of the Helicobacter adherence molecule Muc5ac. When the expression of Muc5ac was examined in this study both by immunohistochemistry, as well as by qRT-PCR, it was shown that there was decreased expression in all three animal models. This leads to the 115 conclusion that loss of Muc5ac it is not responsible for the difference in clearance of the H. felis bacteria between the three models. As antibodies play a role in the clearance of multiple bacteria, we investigated whether antibodies could be playing a role in the differential clearance of the bacteria in these mouse models. Although total serum and fecal IgA did not differ between groups, no H. felis-specific fecal IgA was ever produced in the B6.GB and B6.ASF animals, even after 24 weeks of infection. Although it remains a possibility that the lack of Helicobacter-specific secretory IgA is the mechanism behind why these mice are not clearing the H. felis, we believe that is not the explanation based on our previous studies. These experiments have shown that the B6.MT animals, which lack B cells and antibodies, are able to clear H. felis during infection (8). Consequently, the presence or absence of antibody is probably not responsible for differences in bacterial clearance during the infection in these mouse models. Our laboratory has shown that the adaptive immune response, specifically the CD4+ T-cell, is critical in the development of gastritis and the subsequent gastric pathology seen after H. felis infection. Therefore, we characterized the expression level of three representative CD4 T-cell cytokines or transcription factors (Th1-IFN, Th17IL17, and Treg-FoxP3) to determine if a specific T-cell subset was over- or underrepresented in each of these animal models. There was no difference in IFN between the three animal models showing that this characteristic Th1 cytokine is not responsible for the clearance of the H. felis, but may play a role in the histological alterations seen in all three mouse models. As Th17 cells have been shown to play a role in the development of chronic inflammation in other inflammatory animal models, we 116 examined the level of IL17 expression (42-44). Surprisingly, the B6.GB showed a significant increase in expression as compared to the B6.SPF and B6.ASF. As the B6.GB did not contain any other bacteria in the stomach to activate these Th17 cells, it is clear that H. felis, alone, is sufficient to stimulate IL-17 production and suggests that IL17, perhaps in conjunction with IFN, is part of the mechanism driving the ongoing chronic inflammation evident in this model. It is thought that Tregs are involved in suppressing the immune response in H. pylori infection (45). The B6.SPF and B6.GB had an increased expression of Foxp3 showing that it is not responsible for the clearance of the H. felis and that the presence of regulatory T cells are not sufficient to downregulate chronic gastric inflammation. These studies have shown that there are multiple immunological mechanisms that can result in similar gastric histology after H. felis infection. One mechanism appears to be an altered gastric niche, which allows the colonization of the additional bacteria in the B6.SPF animals. By limiting the gastric microbiota in the B6.GB and B6.ASF animals, we have eliminated these additional bacteria from playing a role in their chronic pathology; however, there appear to be other alternative mechanisms playing a role in these mice. First, they are unable to clear the H. felis infection, even though there is a similar loss of the adherence glycoprotein in all three models. Second, they appear unable to mount a specific secretory anti-H. felis IgA response. The reasons for this lack of specific secretory response are currently unknown. Third, these strains have significant alterations in their ability to mount Th17 and Treg responses. The B6.GB stomach is clearly dominated by a Th17 response after H. felis infection, but still has an increased Treg response (as measured by Foxp3 expression). However, the B6.ASF 117 model does not appear to generate either Th17 or Tregs in the stomach after H. felis infection. Clearly, additional studies will be needed to elucidate the specific mechanisms behind these differences in disease pathology in these unique mouse models. Further studies are currently underway to elucidate if the dysplastic lesions seen in the 24 week infected B6.GB and B6.ASF animals will progress to gastric adenocarcinoma in a similar fashion as the H. felis infected B6.SPF animals. 118 Acknowledgements This work was supported in part by a grant from the American Cancer Society (RPG-99-086-01-MBC), National Institutes of Health (NIH) Grants R01 DK-059911 and P01 DK-071176, and the University of Alabama at Birmingham Digestive Diseases Research Development Center Grant #P 30 DK-064400. J.M.S. received salary support from NIH Training Grant T32 AI-07041. We thank Charyl Roy for technical assistance with the Gnotobiotic and Genetically Engineered Mouse Core, Jamie McNaught for her work with the Histology Core, as well as Anna Seay and Scott Tanner for their technical assistance. 119 References 1. Correa, P., and M. B. Piazuelo. 2008. Natural history of Helicobacter pylori infection. Dig Liver Dis. 2. Tan, M. P., M. Kaparakis, M. Galic, J. Pedersen, M. Pearse, O. L. Wijburg, P. H. Janssen, and R. A. Strugnell. 2007. Chronic Helicobacter pylori infection does not significantly alter the microbiota of the murine stomach. Appl Environ Microbiol 73:1010. 3. Peek Jr., R. M. 2002. New insights into microbially initiated gastric malignancies: Beyond the usual suspects. Gastroenterology 123. 4. Vanagunas, A. 1998. The Link Between Helicobacter pylori and Gastric Cancer. Infect Med 15:644. 5. Cai, X., J. Carlson, C. Stoicov, H. Li, T. C. Wang, and J. Houghton. 2005. Helicobacter felis eradication restores normal architecture and inhibits gastric cancer progression in C57BL/6 mice. Gastroenterology 128:1937. 6. Parkin, D. M., F. Bray, J. Ferlay, and P. Pisani. 2005. Global cancer statistics, 2002. CA Cancer J Clin 55:74. 7. McCracken, V. J., S. M. Martin, and R. G. Lorenz. 2005. The Helicobacter felis model of adoptive transfer gastritis. Immunol Res 33:183. 8. Roth, K. A., S. B. Kapadia, S. M. Martin, and R. G. Lorenz. 1999. Cellular immune responses are essential for the development of Helicobacter felisassociated gastric pathology. J Immunol 163:1490. 9. Ogura, K., S. Maeda, M. Nakao, T. Watanabe, M. Tada, T. Kyutoku, H. Yoshida, Y. Shiratori, and M. Omata. 2000. Virulence factors of Helicobacter pylori responsible for gastric diseases in Mongolian gerbil. J Exp Med 192:1601. 10. Watanabe, T., M. Tada, H. Nagai, S. Sasaki, and M. Nakao. 1998. Helicobacter pylori infection induces gastric cancer in mongolian gerbils. Gastroenterology 115:642. 11. Savage, D. C. 1977. Microbial ecology of the gastrointestinal tract. Annu Rev Microbiol 31:107. 12. Rathinavelu, S., Y. Zavros, and J. L. Merchant. 2003. Acinetobacter lwoffii infection and gastritis. Microbes Infect 5:651. 120 13. Zavros, Y., G. Rieder, A. Ferguson, and J. L. Merchant. 2002. Gastritis and hypergastrinemia due to Acinetobacter lwoffii in mice. Infect Immun 70:2630. 14. Bik, E. M., P. B. Eckburg, S. R. Gill, K. E. Nelson, E. A. Purdom, F. Francois, G. Perez-Perez, M. J. Blaser, and D. A. Relman. 2006. Molecular analysis of the bacterial microbiota in the human stomach. Proc Natl Acad Sci U S A 103:732. 15. Eckburg, P. B., E. M. Bik, C. N. Bernstein, E. Purdom, L. Dethlefsen, M. Sargent, S. R. Gill, K. E. Nelson, and D. A. Relman. 2005. Diversity of the human intestinal microbial flora. Science 308:1635. 16. Wang, X., S. P. Heazlewood, D. O. Krause, and T. H. Florin. 2003. Molecular characterization of the microbial species that colonize human ileal and colonic mucosa by using 16S rDNA sequence analysis. J Appl Microbiol 95:508. 17. Savage, D. C., R. Dubos, and R. W. Schaedler. 1968. The gastrointestinal epithelium and its autochthonous bacterial flora. J Exp Med 127:67. 18. Yamaguchi, H., T. Osaki, H. Taguchi, N. Sato, A. Toyoda, M. Takahashi, M. Kai, N. Nakata, A. Komatsu, Y. Atomi, and S. Kamiya. 2003. Effect of bacterial flora on postimmunization gastritis following oral vaccination of mice with Helicobacter pylori heat shock protein 60. Clin Diagn Lab Immunol 10:808. 19. Aebischer, T., A. Fischer, A. Walduck, C. Schlotelburg, M. Lindig, S. Schreiber, T. F. Meyer, S. Bereswill, and U. B. Gobel. 2006. Vaccination prevents Helicobacter pylori-induced alterations of the gastric flora in mice. FEMS Immunol Med Microbiol 46:221. 20. Lee, A., J. G. Fox, G. Otto, and J. Murphy. 1990. A small animal model of human Helicobacter pylori active chronic gastritis. Gastroenterology 99:1315. 21. Fox, J. G., M. Blanco, J. C. Murphy, N. S. Taylor, A. Lee, Z. Kabok, and J. Pappo. 1993. Local and systemic immune responses in murine Helicobacter felis active chronic gastritis. Infect Immun 61:2309. 22. Gordon, H. A., and L. Pesti. 1971. The gnotobiotic animal as a tool in the study of host microbial relationships. Bacteriol Rev 35:390. 23. Dewhirst, F. E., C. C. Chien, B. J. Paster, R. L. Ericson, R. P. Orcutt, D. B. Schauer, and J. G. Fox. 1999. Phylogeny of the defined murine microbiota: altered Schaedler flora. Appl Environ Microbiol 65:3287. 24. Sarma-Rupavtarm, R. B., Z. Ge, D. B. Schauer, J. G. Fox, and M. F. Polz. 2004. Spatial distribution and stability of the eight microbial species of the altered schaedler flora in the mouse gastrointestinal tract. Appl Environ Microbiol 70:2791. 121 25. Schaedler, R. W., R. Dubs, and R. Costello. 1965. Association Of Germfree Mice With Bacteria Isolated From Normal Mice. J Exp Med 122:77. 26. Smith, K., K. D. McCoy, and A. J. Macpherson. 2007. Use of axenic animals in studying the adaptation of mammals to their commensal intestinal microbiota. Semin Immunol 19:59. 27. Deloris Alexander, A., R. P. Orcutt, J. C. Henry, J. Baker, Jr., A. C. Bissahoyo, and D. W. Threadgill. 2006. Quantitative PCR assays for mouse enteric flora reveal strain-dependent differences in composition that are influenced by the microenvironment. Mamm Genome 17:1093. 28. Johnson, M. J., E. Thatcher, and M. E. Cox. 1995. Techniques for controlling variability in gram staining of obligate anaerobes. J Clin Microbiol 33:755. 29. McLoughlin, R. M., R. M. Solinga, J. Rich, K. J. Zaleski, J. L. Cocchiaro, A. Risley, A. O. Tzianabos, and J. C. Lee. 2006. CD4+ T cells and CXC chemokines modulate the pathogenesis of Staphylococcus aureus wound infections. Proc Natl Acad Sci U S A 103:10408. 30. Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156. 31. Heid, C. A., J. Stevens, K. J. Livak, and P. M. Williams. 1996. Real time quantitative PCR. Genome Res 6:986. 32. Bas, A., G. Forsberg, S. Hammarstrom, and M. L. Hammarstrom. 2004. Utility of the housekeeping genes 18S rRNA, beta-actin and glyceraldehyde-3-phosphatedehydrogenase for normalization in real-time quantitative reverse transcriptasepolymerase chain reaction analysis of gene expression in human T lymphocytes. Scand J Immunol 59:566. 33. Brown, J. K., A. D. Pemberton, S. H. Wright, and H. R. Miller. 2004. Primary antibody-Fab fragment complexes: a flexible alternative to traditional direct and indirect immunolabeling techniques. J Histochem Cytochem 52:1219. 34. Chen, Y., Y. H. Zhao, T. B. Kalaslavadi, E. Hamati, K. Nehrke, A. D. Le, D. K. Ann, and R. Wu. 2004. Genome-wide search and identification of a novel gelforming mucin MUC19/Muc19 in glandular tissues. Am J Respir Cell Mol Biol 30:155. 35. Kaneko, Y., K. Yanagihara, Y. Miyazaki, Y. Hirakata, H. Mukae, K. Tomono, Y. Okada, J. Kadota, and S. Kohno. 2003. Overproduction of MUC5AC core protein in patients with diffuse panbronchiolitis. Respiration 70:475. 122 36. Van de Bovenkamp, J. H., J. Mahdavi, A. M. Korteland-Van Male, H. A. Buller, A. W. Einerhand, T. Boren, and J. Dekker. 2003. The MUC5AC glycoprotein is the primary receptor for Helicobacter pylori in the human stomach. Helicobacter 8:521. 37. Van den Brink, G. R., K. M. Tytgat, R. W. Van der Hulst, C. M. Van der Loos, A. W. Einerhand, H. A. Buller, and J. Dekker. 2000. H pylori colocalises with MUC5AC in the human stomach. Gut 46:601. 38. Ho, S. B., L. L. Shekels, N. W. Toribara, Y. S. Kim, C. Lyftogt, D. L. Cherwitz, and G. A. Niehans. 1995. Mucin gene expression in normal, preneoplastic, and neoplastic human gastric epithelium. Cancer Res 55:2681. 39. Marques, T., L. David, C. Reis, and A. Nogueira. 2005. Topographic expression of MUC5AC and MUC6 in the gastric mucosa infected by Helicobacter pylori and in associated diseases. Pathol Res Pract 201:665. 40. Mohammadi, M., J. Nedrud, R. Redline, N. Lycke, and S. J. Czinn. 1997. Murine CD4 T-cell response to Helicobacter infection: TH1 cells enhance gastritis and TH2 cells reduce bacterial load. Gastroenterology 113:1848. 41. Bamford, K. B., X. Fan, S. E. Crowe, J. F. Leary, W. K. Gourley, G. K. Luthra, E. G. Brooks, D. Y. Graham, V. E. Reyes, and P. B. Ernst. 1998. Lymphocytes in the human gastric mucosa during Helicobacter pylori have a T helper cell 1 phenotype. Gastroenterology 114:482. 42. Luzza, F., T. Parrello, G. Monteleone, L. Sebkova, M. Romano, R. Zarrilli, M. Imeneo, and F. Pallone. 2000. Up-regulation of IL-17 is associated with bioactive IL-8 expression in Helicobacter pylori-infected human gastric mucosa. J Immunol 165:5332. 43. Mizuno, T., T. Ando, K. Nobata, T. Tsuzuki, O. Maeda, O. Watanabe, M. Minami, K. Ina, K. Kusugami, R. M. Peek, and H. Goto. 2005. Interleukin-17 levels in Helicobacter pylori-infected gastric mucosa and pathologic sequelae of colonization. World J Gastroenterol 11:6305. 44. Weaver, C. T., R. D. Hatton, P. R. Mangan, and L. E. Harrington. 2007. IL-17 family cytokines and the expanding diversity of effector T cell lineages. Annu Rev Immunol 25:821. 45. Lundgren, A., E. Suri-Payer, K. Enarsson, A. M. Svennerholm, and B. S. Lundin. 2003. Helicobacter pylori-specific CD4+ CD25high regulatory T cells suppress memory T-cell responses to H. pylori in infected individuals. Infect Immun 71:1755. 123 CONCLUSIONS Although many studies have been done on the effects of Helicobacter on disease progression, there is still much to learn about the immunology and mucin alterations. The immune response contributes to the severity of the disease, making this a critical piece of information to understand (7). Through the use of qRT-PCR we have demonstrated that there is a change in the immune response in infected animals. By combining this knowledge with experiments done on knock-out animals, we can begin to understand the mechanism of the disease progression. Initially, studies focused on the expression of CXCL15 (Lungkine) and its expression throughout the gastrointestinal, urogenital, and endocrine systems. A we believe that the immune response is only one part of the puzzle, studies began on studying the mucin and trefoil alternation seen in the C57BL/6 model of H. felis infection. The results from these two focuses led us to study the effects of the immune response and mucins changes with an altered microbiota. The studies presented in this dissertation have demonstrated the importance of the immune system and mucin alterations in the progression to gastric adenocarcinoma after infection with H. felis. The expression of CXCL15 in the gastrointestinal, urogenital, and endocrine tract has not been studied previously. CXCL15 is part of the ELR+ CXC family which are involved in neutrophil recruitment and promotion of angiogenesis. Its expression has been shown in the adult lung of inbred mouse strains. However no expression was evident in lymphoid organs such as the spleen. In response to inflammatory stimuli, CXCL15 expression is upregulated in the lung being released by the bronchoepithelial cells (53). It then functions to increase the neutrophil migration into the airway spaces. A 124 knockout of CXCL15 has been created and is shown to have an increased pulmonary bacterial load when infected with Klebsiella pneumoniae as compared to infected wildtype mice (52). As the neutrophil response has been shown to be increased in mice infected with H. felis, we needed to evaluate the expression of CXCL15 in the gastrointestinal tract, as it had not been studied previously (80). At baseline, CXCL15 was expressed in all the organs of the gastrointestinal tract except for the cecum. In a stomach infected with H. felis for eight weeks there was an increase of CXLC15 by RNA expression. When analyzing its expression in two models of colitis, also studied in our lab, it was shown to be decreased, thus not playing a significant role in these two models. As the H. felis model of infection progresses to gastric adenocarcinoma, CXCL15 could be playing a key role in the disease. Further studies to analyze the effect of H. felis in a knockout mouse of CXCL15 could lead to further understanding of the mechanisms. Attempts have been made to obtain this mouse for our studies, but we have been unsuccessful in obtaining them. As recent reports have shown that Helicobacterassociated gastric cancer originates in the bone marrow stem cells, it is thought that CXCL15 could be acting as a chemoattractant for the bone marrow progenitor cells in the disease model (81, 82). As the C57BL/6 model is a well-used model for H. felis infection, it is important to see how closely the model mimics the human disease progression. Previous studies have been done to analyze the changes of the mucins and trefoil factors in human stomachs. MUC1 and TFF2 are expressed early in the disease process, whereas MUC2, MUC3, MUC4, MUC5B, and TFF3 are expressed in gastric adenocarcinomas. MUC5AC, MUC6, and TFF1 expression is lost in the stomach during the progression to 125 gastric adenocarcinoma (25, 26, 34-37, 83-86). But no comprehensive study has been done to analyze all the murine mucins and trefoil factors over the course of the disease progression. Studies have focused on the expression of TFF2 in the mouse model. It was shown that TFF2-/- infected with H. felis had increased susceptibility to H. felis gastritis, and the studies suggested a role for TFF2 in controlling gastrointestinal repair but also regulating mononuclear cell inflammatory responses (38). Our study showed that the histology mimics what is seen in humans, confirming data from other laboratories (8, 87). Through an extensive qRT-PCR study the expression of murine mucins and Trefoil factors were mapped over the course of infection with H. felis in the mouse model. We showed by qRT-PCR that Muc4, Muc5b, and TFF1 expression mimicked what is known about these in the human disease. By immunofluorescence, Muc5ac resembles what happens in the human disease, but since this is not globally lost throughout the entire stomach, a decrease in RNA expression is not evident. Through the use of immunofluorescence we were able to confirm that the murine protein expression correlated with the RNA expression for the murine model for Muc1, Muc3, and Muc4, although only Muc4 reproduced what is seen in the human disease. While all of our data did not mimic the human mucin expression, this could be due to the time points of infection. The human expression of mucins normally is reported in stomachs that are afflicted with gastric adenocarcinoma, whereas our animal model focused more on the earlier time points which maps what happens during the course of the infection. By using the B6.RAG mice we were able to determine the changes that occur with the mucins and trefoil factors in a model that does contain the adaptive system. Previous studies have shown that the innate immune system is not sufficient to generate the histological 126 changes seen in the progression to gastric adenocarcinoma (70, 73). There was no change in Muc4 and Muc5b in the B6.RAG, which were increased in the B6 model, leading us to conclude that the changes are due to the adaptive immune system. As the changes were occurring early in the disease, Muc4 and Muc5b could be markers for dysplasia, allowing doctors to detect the progression to gastric adenocarcinoma earlier. The immune responses and mucin changes are only part of the puzzle; other factors are clearly playing a role in the disease progression, especially other bacteria. Previously the stomach was thought to be sterile but with more sensitive detection methods, this has been proven false. Earlier studies by other labs have shown that infection with H. pylori in the mouse model required additional bacteria for the induction of post-immunization gastritis in the mice. These additional bacteria included bacteria that are normally located in the lower intestinal tract, thus showing that H. pylori is potentially enabling these bacteria to adapt to the gastric conditions (88, 89). Unpublished DGGE data in our lab has shown that mice infected with H. felis for eight weeks showed additional bands of bacteria not evident in the mock stomachs. This led us to using the gnotobiotic facility on campus. We infected germ-free (B6.GB) and Altered Schaedler Flora (B6.ASF) mice with H. felis and analyzed the changes over the course of infection. The histological changes seen in the B6.GB and B6.ASF mice were similar to what is seen in our B6 model of infection (B6.SPF). The colonization levels in the B6.GB and B6.ASF mice did not clear as seen in the B6.SPF infection, thus causing a different stimulation of inflammation from the B6.SPF, as the B6.GB and B6.ASF were constantly stimulated with H. felis. The B6.SPF could be receiving stimulation from additional bacteria that are present in the stomach. We were able to replicate the data seen 127 previously in our lab by DGGE. Stomachs of B6.SPF animals that had been infected for 8 and 24 weeks showed additional bacteria present that were not evident in the mock animals. When comparing these bacterial bands to the bands seen in the B6.ASF animals, we observed that they did not correlate, leading us to conclude that one of the eight strains in the ASF are not the additional bacteria evident in the B6.SPF animals. Further studies would be needed to determine exactly what bacteria are evident in these bands. Once these are determined dual infection in a germ-free mouse with H. felis and a bacterium that is evident in the B6.SPF animal could determine whether these additional bacteria are needed for the progression to gastric adenocarcinoma. Since the lost of Muc5ac is a crucial concept in the human and mouse models, we analyzed its expression in the altered microbiota animal models to determine if bacteria are playing a role in its decreased expression. Expression was analyzed by qRT-PCR and immunofluorescene, showing no difference in the expression level as compared to the B6.SPF infected animals. The change in the microbiota does not play a role in the loss of Muc5ac in this disease. As antibodies are thought to play a role in the clearance of multiple bacteria, we analyzed the expression levels in the three animal models. The B6.GB and B6.ASF did not produce fecal Helicobacter specific IgA over the course of the infection. This lack of production could explain why these animals did not clear H. felis, but studies on B6.MT have shown that antibodies are not necessary for the clearance of H. felis (70). As the immune response is altered in the mouse model of disease, we wondered whether the same changes still occur in the altered microbiota. All three models had an increase of IFN, which is characteristic of the Th1 response seen in Helicobacter disease. IL-17 was highly upregulated in the B6.GB animals and increased in the B6.SPF. Interestingly in 128 the B6.ASF there was no change from baseline, suggesting that the eight bacteria present are not stimulators of IL-17. Foxp3 was increased in the B6.SPF and B6.GB but was not changed in B6.ASF. This shows that one of the eight bacteria of the ASF could be playing a role in the lack of change seen in the T regulatory response. Infection of the B6.GB and B6.ASF animals for one year with H. felis would allow us to elucidate if the altered microbiota coordinates to the development of gastric adenocarcinoma. We have characterized the expression of CXCL15 expression in the gastrointestinal, uorgenital, and endocrine tract, showing that it is not limited to the lung only. This expression could lead to discovering its role in inflammatory diseases other than pulmonary infections. While the changes in mucins and trefoil factors are widely known in the human disease, no one has attempted to characterize all the changes seen in the mouse model. To be able to diagnose an individual early in the disease process, the changes seen early on in the infection need to be better understood. The disease progression was analyzed in an altered microbiota state to determine if there was a key bacterium causing the immune response. Figure 5 is a summary of the knowledge of the disease progression that has been obtained in my research here. My hypothesis set out to prove that there was a sequence of events leading to cancer, starting with immune changes which then led to changes in the mucins followed by gastric adenocarcinoma. While the key cytokine has not been determined in the model, showing how little we completely understand about the disease, there is evidence that mucin changes are extremely important both in the human disease and in the mouse model. 129 Normal Colonization of H. felis Chronic gastritis Increase in CXCL15 Atrophy Loss of parietal cells = increased pH (other bacteria) Loss of muc5ac and TFF1 Appearance of muc4 and muc5b Increase in IL-17, IFN, and Foxp3 Metaplasia Disappearance of H. felis Adenocarcinoma Figure 1: Diagram of the histological changes in the progression to gastric adenocarcinoma. The boxes to the right of the figure indicate what is now known in the mouse model of the disease. 130 GENERAL LIST OF REFERENCES 1. Peek Jr., R. M. 2002. New insights into microbially initiated gastric malignancies: Beyond the usual suspects. Gastroenterology 123. 2. Vanagunas, A. 1998. The Link Between Helicobacter pylori and Gastric Cancer. Infect Med 15:644. 3. Hohenberger, P. G., Stephan. 2003. Gastric Cancer. The Lancet 362:305. 4. Lauren, P. 1965. The Two Histological Main Types Of Gastric Carcinoma: Diffuse And So-Called Intestinal-Type Carcinoma. An Attempt At A HistoClinical Classification. Acta Pathol Microbiol Scand 64:31. 5. Warren, B. J. M. J. R. 1984. Unidentified Curved Bacilli in the Stomach of Patients with Gastritis and Peptic Ulceration. The Lancet 8390:1311. 6. Clyne, M., P. Dillon, S. Daly, R. O'Kennedy, F. E. May, B. R. Westley, and B. Drumm. 2004. Helicobacter pylori interacts with the human single-domain trefoil protein TFF1. Proc Natl Acad Sci U S A 101:7409. 7. Telford, J. L., A. Covacci, R. Rappuoli, and P. Chiara. 1997. Immunobiology of Helicobacter pylori infection. Curr Opin Immunol 9:498. 8. Cai, X., J. Carlson, C. Stoicov, H. Li, T. C. Wang, and J. Houghton. 2005. Helicobacter felis eradication restores normal architecture and inhibits gastric cancer progression in C57BL/6 mice. Gastroenterology 128:1937. 9. Katoh, M. 2003. Trefoil factors and human gastric cancer (review). Int J Mol Med 12:3. 10. Fox, J. G., and T. C. Wang. 2007. Inflammation, atrophy, and gastric cancer. J Clin Invest 117:60. 11. Karnes, W. E., Jr., I. M. Samloff, M. Siurala, M. Kekki, P. Sipponen, S. W. Kim, and J. H. Walsh. 1991. Positive serum antibody and negative tissue staining for Helicobacter pylori in subjects with atrophic body gastritis. Gastroenterology 101:167. 12. Kikuchi, S. 2002. Epidemiology of Helicobacter pylori and gastric cancer. Gastric Cancer 5:6. 13. Thompson, L. J., S. J. Danon, J. E. Wilson, J. L. O'Rourke, N. R. Salama, S. Falkow, H. Mitchell, and A. Lee. 2004. Chronic Helicobacter pylori infection 131 with Sydney strain 1 and a newly identified mouse-adapted strain (Sydney strain 2000) in C57BL/6 and BALB/c mice. Infect Immun 72:4668. 14. Ito, S. 1987. Functional Gastric Morphology. In Physiology of the Gastrointestinal Tract, p. 817. 15. Cahill, R. J., C. Kilgallen, S. Beattie, H. Hamilton, and C. O'Morain. 1996. Gastric epithelial cell kinetics in the progression from normal mucosa to gastric carcinoma. Gut 38:177. 16. Lynch, D. A., N. P. Mapstone, A. M. Clarke, G. M. Sobala, P. Jackson, L. Morrison, M. F. Dixon, P. Quirke, and A. T. Axon. 1995. Cell proliferation in Helicobacter pylori associated gastritis and the effect of eradication therapy. Gut 36:346. 17. Chen, Y., Y. H. Zhao, T. B. Kalaslavadi, E. Hamati, K. Nehrke, A. D. Le, D. K. Ann, and R. Wu. 2004. Genome-wide search and identification of a novel gelforming mucin MUC19/Muc19 in glandular tissues. Am J Respir Cell Mol Biol 30:155. 18. Kaneko, Y., K. Yanagihara, Y. Miyazaki, Y. Hirakata, H. Mukae, K. Tomono, Y. Okada, J. Kadota, and S. Kohno. 2003. Overproduction of MUC5AC core protein in patients with diffuse panbronchiolitis. Respiration 70:475. 19. Shirazi, T., R. J. Longman, A. P. Corfield, and C. S. Probert. 2000. Mucins and inflammatory bowel disease. Postgrad Med J 76:473. 20. Higuchi, T., T. Orita, S. Nakanishi, K. Katsuya, H. Watanabe, Y. Yamasaki, I. Waga, T. Nanayama, Y. Yamamoto, W. Munger, H. W. Sun, R. J. Falk, J. C. Jennette, D. A. Alcorta, H. Li, T. Yamamoto, Y. Saito, and M. Nakamura. 2004. Molecular cloning, genomic structure, and expression analysis of MUC20, a novel mucin protein, up-regulated in injured kidney. J Biol Chem 279:1968. 21. Ringel, J., and M. Lohr. 2003. The MUC gene family: their role in diagnosis and early detection of pancreatic cancer. Mol Cancer 2:9. 22. Kawakubo, M., Y. Ito, Y. Okimura, M. Kobayashi, K. Sakura, S. Kasama, M. N. Fukuda, M. Fukuda, T. Katsuyama, and J. Nakayama. 2004. Natural antibiotic function of a human gastric mucin against Helicobacter pylori infection. Science 305:1003. 23. Escande, F., N. Porchet, A. Bernigaud, D. Petitprez, J. P. Aubert, and M. P. Buisine. 2004. The mouse secreted gel-forming mucin gene cluster. Biochim Biophys Acta 1676:240. 132 24. Babu, S. D., V. Jayanthi, N. Devaraj, C. A. Reis, and H. Devaraj. 2006. Expression profile of mucins (MUC2, MUC5AC and MUC6) in Helicobacter pylori infected pre-neoplastic and neoplastic human gastric epithelium. Mol Cancer 5:10. 25. Ho, S. B., L. L. Shekels, N. W. Toribara, Y. S. Kim, C. Lyftogt, D. L. Cherwitz, and G. A. Niehans. 1995. Mucin gene expression in normal, preneoplastic, and neoplastic human gastric epithelium. Cancer Res 55:2681. 26. Pinto-de-Sousa, J., C. A. Reis, L. David, A. Pimenta, and M. Cardoso-deOliveira. 2004. MUC5B expression in gastric carcinoma: relationship with clinico-pathological parameters and with expression of mucins MUC1, MUC2, MUC5AC and MUC6. Virchows Arch 444:224. 27. Spicer, A. P., G. J. Rowse, T. K. Lidner, and S. J. Gendler. 1995. Delayed mammary tumor progression in Muc-1 null mice. J Biol Chem 270:30093. 28. Lee, H. S., H. K. Lee, H. S. Kim, H. K. Yang, Y. I. Kim, and W. H. Kim. 2001. MUC1, MUC2, MUC5AC, and MUC6 expressions in gastric carcinomas: their roles as prognostic indicators. Cancer 92:1427. 29. Velcich, A., W. Yang, J. Heyer, A. Fragale, C. Nicholas, S. Viani, R. Kucherlapati, M. Lipkin, K. Yang, and L. Augenlicht. 2002. Colorectal cancer in mice genetically deficient in the mucin Muc2. Science 295:1726. 30. Ruchaud-Sparagano, M. H., B. R. Westley, and F. E. May. 2004. The trefoil protein TFF1 is bound to MUC5AC in human gastric mucosa. Cell Mol Life Sci 61:1946. 31. Lefebvre, O., M. P. Chenard, R. Masson, J. Linares, A. Dierich, M. LeMeur, C. Wendling, C. Tomasetto, P. Chambon, and M. C. Rio. 1996. Gastric mucosa abnormalities and tumorigenesis in mice lacking the pS2 trefoil protein. Science 274:259. 32. Farrell, J. J. T., Douglas; Koh, Theodore J.; Chen, Duan; Zhao, Chun-Mei; Podolsky, Daniel K.; and Wang, Timothy C. 2002. TFF2/SP-deficient mice show decreased gastric proliferation, increased acid secretion, and increased susceptibility to NSAID injury. J Clin. Invest 109:193. 33. Mashimo, H., D. C. Wu, D. K. Podolsky, and M. C. Fishman. 1996. Impaired defense of intestinal mucosa in mice lacking intestinal trefoil factor. Science 274:262. 34. Roessler, K., S. P. Monig, P. M. Schneider, F. G. Hanisch, S. Landsberg, J. Thiele, A. H. Holscher, H. P. Dienes, and S. E. Baldus. 2005. Co-expression of 133 CDX2 and MUC2 in gastric carcinomas: correlations with clinico-pathological parameters and prognosis. World J Gastroenterol 11:3182. 35. Dhar, D. K., T. C. Wang, H. Tabara, Y. Tonomoto, R. Maruyama, M. Tachibana, H. Kubota, and N. Nagasue. 2005. Expression of trefoil factor family members correlates with patient prognosis and neoangiogenesis. Clin Cancer Res 11:6472. 36. Marques, T., L. David, C. Reis, and A. Nogueira. 2005. Topographic expression of MUC5AC and MUC6 in the gastric mucosa infected by Helicobacter pylori and in associated diseases. Pathol Res Pract 201:665. 37. Hu, G. Y., B. P. Yu, W. G. Dong, M. Q. Li, J. P. Yu, H. S. Luo, and Z. X. Rang. 2003. Expression of TFF2 and Helicobacter pylori infection in carcinogenesis of gastric mucosa. World J Gastroenterol 9:910. 38. Kurt-Jones, E. A., L. Cao, F. Sandor, A. B. Rogers, M. T. Whary, P. R. Nambiar, A. Cerny, G. Bowen, J. Yan, S. Takaishi, A. L. Chi, G. Reed, J. Houghton, J. G. Fox, and T. C. Wang. 2007. Trefoil family factor 2 is expressed in murine gastric and immune cells and controls both gastrointestinal inflammation and systemic immune responses. Infect Immun 75:471. 39. O'Keeffe, J., and A. P. Moran. 2008. Conventional, regulatory, and unconventional T cells in the immunologic response to Helicobacter pylori. Helicobacter 13:1. 40. Lundgren, A., E. Suri-Payer, K. Enarsson, A. M. Svennerholm, and B. S. Lundin. 2003. Helicobacter pylori-specific CD4+ CD25high regulatory T cells suppress memory T-cell responses to H. pylori in infected individuals. Infect Immun 71:1755. 41. Luzza, F., T. Parrello, G. Monteleone, L. Sebkova, M. Romano, R. Zarrilli, M. Imeneo, and F. Pallone. 2000. Up-regulation of IL-17 is associated with bioactive IL-8 expression in Helicobacter pylori-infected human gastric mucosa. J Immunol 165:5332. 42. Mizuno, T., T. Ando, K. Nobata, T. Tsuzuki, O. Maeda, O. Watanabe, M. Minami, K. Ina, K. Kusugami, R. M. Peek, and H. Goto. 2005. Interleukin-17 levels in Helicobacter pylori-infected gastric mucosa and pathologic sequelae of colonization. World J Gastroenterol 11:6305. 43. Harrington, L. E., R. D. Hatton, P. R. Mangan, H. Turner, T. L. Murphy, K. M. Murphy, and C. T. Weaver. 2005. Interleukin 17-producing CD4+ effector T cells develop via a lineage distinct from the T helper type 1 and 2 lineages. Nat Immunol 6:1123. 134 44. Kolls, J. K., and A. Linden. 2004. Interleukin-17 family members and inflammation. Immunity 21:467. 45. Park, H., Z. Li, X. O. Yang, S. H. Chang, R. Nurieva, Y. H. Wang, Y. Wang, L. Hood, Z. Zhu, Q. Tian, and C. Dong. 2005. A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17. Nat Immunol 6:1133. 46. Steinman, L. 2007. A brief history of T(H)17, the first major revision in the T(H)1/T(H)2 hypothesis of T cell-mediated tissue damage. Nat Med 13:139. 47. Weaver, C. T., R. D. Hatton, P. R. Mangan, and L. E. Harrington. 2007. IL-17 family cytokines and the expanding diversity of effector T cell lineages. Annu Rev Immunol 25:821. 48. McAllister, F., A. Henry, J. L. Kreindler, P. J. Dubin, L. Ulrich, C. Steele, J. D. Finder, J. M. Pilewski, B. M. Carreno, S. J. Goldman, J. Pirhonen, and J. K. Kolls. 2005. Role of IL-17A, IL-17F, and the IL-17 receptor in regulating growth-related oncogene-alpha and granulocyte colony-stimulating factor in bronchial epithelium: implications for airway inflammation in cystic fibrosis. J Immunol 175:404. 49. Chen, Y., P. Thai, Y. H. Zhao, Y. S. Ho, M. M. DeSouza, and R. Wu. 2003. Stimulation of airway mucin gene expression by interleukin (IL)-17 through IL-6 paracrine/autocrine loop. J Biol Chem 278:17036. 50. Ye, P., F. H. Rodriguez, S. Kanaly, K. L. Stocking, J. Schurr, P. Schwarzenberger, P. Oliver, W. Huang, P. Zhang, J. Zhang, J. E. Shellito, G. J. Bagby, S. Nelson, K. Charrier, J. J. Peschon, and J. K. Kolls. 2001. Requirement of interleukin 17 receptor signaling for lung CXC chemokine and granulocyte colony-stimulating factor expression, neutrophil recruitment, and host defense. J Exp Med 194:519. 51. Barnes, P. J. 2003. Cytokine-directed therapies for the treatment of chronic airway diseases. Cytokine Growth Factor Rev 14:511. 52. Chen, S. C., B. Mehrad, J. C. Deng, G. Vassileva, D. J. Manfra, D. N. Cook, M. T. Wiekowski, A. Zlotnik, T. J. Standiford, and S. A. Lira. 2001. Impaired pulmonary host defense in mice lacking expression of the CXC chemokine lungkine. J Immunol 166:3362. 53. Rossi, D. L., S. D. Hurst, Y. Xu, W. Wang, S. Menon, R. L. Coffman, and A. Zlotnik. 1999. Lungkine, a novel CXC chemokine, specifically expressed by lung bronchoepithelial cells. J Immunol 162:5490. 135 54. Maheshwari, A., R. D. Christensen, D. A. Calhoun, R. A. Dimmitt, and A. Lacson. 2004. Circulating CXC-chemokine concentrations in a murine intestinal ischemia-reperfusion model. Fetal Pediatr Pathol 23:145. 55. Braunstahl, G. J. 2005. The unified immune system: respiratory tractnasobronchial interaction mechanisms in allergic airway disease. J Allergy Clin Immunol 115:142. 56. Mestecky, J., J. R. McGhee, S. M. Michalek, R. R. Arnold, S. S. Crago, and J. L. Babb. 1978. Concept of the local and common mucosal immune response. Adv Exp Med Biol 107:185. 57. Busse, P. J., T. F. Zhang, K. Srivastava, B. P. Lin, B. Schofield, S. C. Sealfon, and X. M. Li. 2005. Chronic exposure to TNF-alpha increases airway mucus gene expression in vivo. J Allergy Clin Immunol 116:1256. 58. Suri-Payer, E., and B. Fritzsching. 2006. Regulatory T cells in experimental autoimmune disease. Springer Semin Immunopathol 28:3. 59. Mocellin, S., F. M. Marincola, and H. A. Young. 2005. Interleukin-10 and the immune response against cancer: a counterpoint. J Leukoc Biol. 60. Rennick, D., N. Davidson, and D. Berg. 1995. Interleukin-10 gene knock-out mice: a model of chronic inflammation. Clin Immunol Immunopathol 76:S174. 61. Matsumoto, Y., T. G. Blanchard, M. L. Drakes, M. Basu, R. W. Redline, A. D. Levine, and S. J. Czinn. 2005. Eradication of Helicobacter pylori and resolution of gastritis in the gastric mucosa of IL-10-deficient mice. Helicobacter 10:407. 62. Schroder, K., P. J. Hertzog, T. Ravasi, and D. A. Hume. 2004. Interferon-gamma: an overview of signals, mechanisms and functions. J Leukoc Biol 75:163. 63. Fukao, T., S. Matsuda, and S. Koyasu. 2000. Synergistic effects of IL-4 and IL-18 on IL-12-dependent IFN-gamma production by dendritic cells. J Immunol 164:64. 64. Crabtree, J. E. 1996. Gastric mucosal inflammatory responses to Helicobacter pylori. Aliment Pharmacol Ther 10 Suppl 1:29. 65. Smythies, L. E., K. B. Waites, J. R. Lindsey, P. R. Harris, P. Ghiara, and P. D. Smith. 2000. Helicobacter pylori-induced mucosal inflammation is Th1 mediated and exacerbated in IL-4, but not IFN-gamma, gene-deficient mice. J Immunol 165:1022. 66. El-Omar, E. M., M. Carrington, W. H. Chow, K. E. McColl, J. H. Bream, H. A. Young, J. Herrera, J. Lissowska, C. C. Yuan, N. Rothman, G. Lanyon, M. Martin, 136 J. F. Fraumeni, Jr., and C. S. Rabkin. 2000. Interleukin-1 polymorphisms associated with increased risk of gastric cancer. Nature 404:398. 67. Dinarello, C. A. 1996. Biologic basis for interleukin-1 in disease. Blood 87:2095. 68. Wallace, J. L., M. Cucala, K. Mugridge, and L. Parente. 1991. Secretagoguespecific effects of interleukin-1 on gastric acid secretion. Am J Physiol 261:G559. 69. Bodger, K., and J. E. Crabtree. 1998. Helicobacter pylori and gastric inflammation. Br Med Bull 54:139. 70. Roth, K. A., S. B. Kapadia, S. M. Martin, and R. G. Lorenz. 1999. Cellular immune responses are essential for the development of Helicobacter felisassociated gastric pathology. J Immunol 163:1490. 71. Mombaerts, P., J. Iacomini, R. S. Johnson, K. Herrup, S. Tonegawa, and V. E. Papaioannou. 1992. RAG-1-deficient mice have no mature B and T lymphocytes. Cell 68:869. 72. Kitamura, D., J. Roes, R. Kuhn, and K. Rajewsky. 1991. A B cell-deficient mouse by targeted disruption of the membrane exon of the immunoglobulin mu chain gene. Nature 350:423. 73. McCracken, V. J., S. M. Martin, and R. G. Lorenz. 2005. The Helicobacter felis model of adoptive transfer gastritis. Immunol Res 33:183. 74. Rathinavelu, S., Y. Zavros, and J. L. Merchant. 2003. Acinetobacter lwoffii infection and gastritis. Microbes Infect 5:651. 75. Zavros, Y., G. Rieder, A. Ferguson, and J. L. Merchant. 2002. Gastritis and hypergastrinemia due to Acinetobacter lwoffii in mice. Infect Immun 70:2630. 76. Gordon, H. A., and L. Pesti. 1971. The gnotobiotic animal as a tool in the study of host microbial relationships. Bacteriol Rev 35:390. 77. Dewhirst, F. E., C. C. Chien, B. J. Paster, R. L. Ericson, R. P. Orcutt, D. B. Schauer, and J. G. Fox. 1999. Phylogeny of the defined murine microbiota: altered Schaedler flora. Appl Environ Microbiol 65:3287. 78. Sarma-Rupavtarm, R. B., Z. Ge, D. B. Schauer, J. G. Fox, and M. F. Polz. 2004. Spatial distribution and stability of the eight microbial species of the altered schaedler flora in the mouse gastrointestinal tract. Appl Environ Microbiol 70:2791. 79. Schaedler, R. W., R. Dubs, and R. Costello. 1965. Association Of Germfree Mice With Bacteria Isolated From Normal Mice. J Exp Med 122:77. 137 80. Dundon, W. G., H. Nishioka, A. Polenghi, E. Papinutto, G. Zanotti, P. Montemurro, G. G. Del, R. Rappuoli, and C. Montecucco. 2002. The neutrophilactivating protein of Helicobacter pylori. Int J Med Microbiol 291:545. 81. Houghton, J., C. Stoicov, S. Nomura, A. B. Rogers, J. Carlson, H. Li, X. Cai, J. G. Fox, J. R. Goldenring, and T. C. Wang. 2004. Gastric cancer originating from bone marrow-derived cells. Science 306:1568. 82. Ohneda, O., K. Ohneda, H. Nomiyama, Z. Zheng, S. A. Gold, F. Arai, T. Miyamoto, B. E. Taillon, R. A. McIndoe, R. A. Shimkets, D. A. Lewin, T. Suda, and L. A. Lasky. 2000. WECHE: a novel hematopoietic regulatory factor. Immunity 12:141. 83. Muller, W., and F. Borchard. 1993. pS2 protein in gastric carcinoma and normal gastric mucosa: association with clincopathological parameters and patient survival. J Pathol 171:263. 84. Taupin, D., J. Pedersen, M. Familari, G. Cook, N. Yeomans, and A. S. Giraud. 2001. Augmented intestinal trefoil factor (TFF3) and loss of pS2 (TFF1) expression precedes metaplastic differentiation of gastric epithelium. Lab Invest 81:397. 85. Wang, R. Q., and D. C. Fang. 2006. Effects of Helicobacter pylori infection on mucin expression in gastric carcinoma and pericancerous tissues. J Gastroenterol Hepatol 21:425. 86. Wong, W. M., R. Poulsom, and N. A. Wright. 1999. Trefoil peptides. Gut 44:890. 87. Correa, P., and J. Houghton. 2007. Carcinogenesis of Helicobacter pylori. Gastroenterology 133:659. 88. Aebischer, T., A. Fischer, A. Walduck, C. Schlotelburg, M. Lindig, S. Schreiber, T. F. Meyer, S. Bereswill, and U. B. Gobel. 2006. Vaccination prevents Helicobacter pylori-induced alterations of the gastric flora in mice. FEMS Immunol Med Microbiol 46:221. 89. Yamaguchi, H., T. Osaki, H. Taguchi, N. Sato, A. Toyoda, M. Takahashi, M. Kai, N. Nakata, A. Komatsu, Y. Atomi, and S. Kamiya. 2003. Effect of bacterial flora on postimmunization gastritis following oral vaccination of mice with Helicobacter pylori heat shock protein 60. Clin Diagn Lab Immunol 10:808. 138 139