phytopathology - Türkiye Fitopatoloji Derneği
Transkript
phytopathology - Türkiye Fitopatoloji Derneği
THE JOURNAL OF TURKISH PHYTOPATHOLOGY SCIENTIFIC REVIEW BOARD The Editor-in-Chief and Editorial Boards of The Journal of Turkish Phytopathology would like to extend their sincere appreciation to all those who have worked as referees for the Journal. Thank you for sharing your time, effort and professional expertise. Prof. Dr. Gülay TURHAN Prof. Dr. Ersin ONOĞUR Prof. Dr. Nafiz DELEN Prof. Dr. Figen YILDIZ Prof. Dr. Filiz ERTUNÇ Prof. Dr. Savaş KORKMAZ Prof. Dr. Yeşim AYSAN Prof. Nuh BOYRAZ Assoc. Prof. Dr. Himmet TEZCAN Assoc. Prof. Dr. Seral YÜCEL Assoc. Prof. Dr. Mustafa GÜMÜŞ Asist. Prof. Dr. Sibel DERVİŞ Asist. Prof. Dr. Nedim ÇETİNKAYA Asist. Prof. Dr. Nazlı Dide Kutluk YILMAZ Asist. Prof. Dr. Dr. Kubilay K. BAŞTAŞ Prof. Dr. Semih ERKAN Prof. Dr. F.Sara DOLAR Prof. Dr. Berna TUNALI Prof. Dr. Abuzer SAĞIR Prof. Dr. Mehmet E. GÜLDÜR Prof. Dr. Saadettin BALOĞLU Prof. Dr. Nuray ÖZER Prof. Dr. Murat H.SİPAHİOĞLU Prof. Dr. Çiğdem ULUBAŞ SERÇE Prof. Dr. Semra DEMİR Assoc. Prof. Mine SOYLU Assoc. Prof. Dr. Ömer ERİNCİK Asist. Prof. Dr. Dr. Hülya ÖZGENEN Dr. Aydan KAYA Dr. Üftade GUNER All rights of articles published in this journal are reserved by The Turkish Phytopathological Society. Any use of the material, including reproduction in whole or in part requires permission in writing from The Turkish Phytopathological Society. Meta Basım Matbaacılık Hizmetleri 87 Sok. No. 4 / A Bornova (0.232) 343 64 54 metabasim@gmail.com İzmir, 2013 Basım Tarihi: 22.07.2013 ISSN 0378 - 8024 http://www.fitopatoloji.org.tr THE JOURNAL OF TURKISH PHYTOPATHOLOGY TURKISH PHYTOPATHOLOGICAL SOCIETY VOL. 39 2010, December NO. 1-3 CONTENTS Stolbur Phytoplasma Infections in Potato and Tomato Plants from Different Locations in Turkey Türkiye'nin Değişik Yörelerinden Alinan Patates ve Domates Bitkilerinde Görülen Stolbur Phytoplasma Enfeksiyonlari B. K. ÇAĞLAR, T. ELBEAINO, M. KÜSEK, D. PEHLIVAN, H. FIDAN, M. PORTAKALDALI ......... 1 Solanapyrones Produced by Turkish Isolates of Ascochyta rabiei and Their Phytotoxicity on Chickpeas Ascochyta rabiei’nin Türk İzolatlarının Solanapyrone Üretimi ve Nohutlar Üzerindeki Fitotoksiteleri M. TÜRKKAN, F. S. DOLAR ..................................................................................................................... 9 Reactions of Local Maize Cultivars to Fusarium verticillioides Based on Disease Severity and Production of Pectolytic Enzymes and Zearalenone Toxin Hastalik Şiddeti, Pektolitik Enzim ve Zearalenone Üretimi Açisindan Yerel Misir Çeşitlerinin Fusarium verticillioides ´E Karşi Reaksiyonlari O. BÜYÜK, N. ÖZER ............................................................................................................................... 23 Toxin Production and DNA Sequence Analysis of Turkish Isolates of Ascochyta rabiei, the Causual Agent of Ascochyta Blight in Chickpea Nohutta Ascochyta Yanıklıklık Etmeni Ascochyta rabiei’nın Türk İzolatlarının Toksin Üretimi ve Dna Sekans Analizleri F. Sara DOLAR........................................................................................................................................... 31 Determination of Variety Reaction to Potato Wart Disease (Synchytrium endobioticum) in Potato Planting Areas of Nevsehir Province, Turkey Nevşehir İli Patates Ekiliş Alanlarında Patates Sığıl Hastalığı (Synchytrıum endobıotıcum)’Na Karşı Çeşit Reaksiyonlarının Belirlenmesi H. GÜNAÇTI, A. ERKILIÇ ....................................................................................................................... 39 The Effects of Various Inactivation Treatments on Seed Germination Characteristics in Vegetable Seeds Infected with the Viruses Viral Etmenler İle Enfekteli Sebze Tohumlarına Yapılan Değişik İnaktifleştirme Uygulamalarının Çimlenme Özellikleri Üzerine Etkileri I. C. PAYLAN, S. ERKAN, N. ÇETINKAYA, M. ERGUN, A. CANDAR ............................................. 45 J. Turk. Phytopath., Vol. 39 No. 1-3, 1-8, 2010 ISSN 0378 - 8024 Stolbur Phytoplasma Infections in Potato and Tomato Plants from Different Locations in Turkey Behçet Kemal ÇAĞLAR* Toufic ELBEAINO** Mustafa KÜSEK*** Deniz PEHLIVAN* Hakan FIDAN**** Mustafa PORTAKALDALI**** * Cukurova University, Faculty of Agriculture, Department of Plant Protection, 01330, Adana- Turkey. kcaglar@cu.edu.tr Istituto Agronomico Mediterraneo di Bari, Via Ceglie 9, 70010 Valenzano (BA), Italy *** Kahramanmaraş Sütçü İmam University, Faculty of Agriculture, Department of Plant Protection, Kahramanmaraş, 46100, Turkey. mkusek@ksu.edu.tr **** Biological Control Research Station, 01320, Adana, Turkey ** Accepted for publication February 02, 2013 ABSTRACT During August 2012, a survey and identification of phytoplasmas associated with diseased potato (Solanum tuberosum L.) and tomato (Solanum lycopersycum L.) plants were conducted in four regions, in Turkey. Potato samples with reddish or purplish discoloration and rolling of leaves symptoms were gathered from “Kayseri and Sivas” provinces, whilst tomato samples were collected form plants exhibiting floral abnormalities, sepal hypertrophy, virescence and phyllody symptoms, from Kahramanmaraş and Adana provinces. All symptomatic plants of both species reacted positively when assayed by direct polymerase chain reactions (PCR) using universal primer pair R16F1/R16R0 and nested PCR using R16F2n/R16R2 primers. Phytoplasmas were detected in 32 symptomatic plants, out of 40 samples collected. However, no PCR amplicon products were obtained from the asymptomatic ones (8 plants). BLAST sequence analysis of the 16SrDNA amplicons (1250 bp) showed that the phytoplasma found in potato and tomato samples resembled “Candidatus phytoplama solani” (16SrXII-A ribosomal subgroup member) and shared with this last 99.8% sequence identity. Similar PCR and sequence results were obtained from Cicadula inornata (Cicadellidae), insects collected from affected tomato plants in surveyed fields, when were assayed by PCR and 16SrDNA-sequenced. The RFLP profile of the 1250 bp PCR fragments, restricted with 7 different endonucleases (EcoRI, TaqI, HhaI, AluI, MseI, RsaI and HpaII) usually used for phytoplasma subgroups differentiation, showed identical patterns to “Candidatus phytoplasma solani”. RFLP results were in harmony with the phylogenetic tree constructed with the sequences obtained, which grouped in one cluster all stolbur phytoplasma from Turkey and those of 16SrXII-A ribosomal subgroup members. To our knowledge, all phytoplasma diseases were detected from potatoes and tomatoes in Kayseri, Sivas, Adana and Kahramanmaraş provinces are same phytoplasma. Further investigations are needed to determine whether Cicadula inornata insect, trapped from affected plants is a potential vector responsible for the transmission of this phytoplasma in that area, where tomatoes are grown in Turkey. Key words: 16S rRNA, PCR, RFLP, sequencing and phylogenetic analysis 1 STOLBUR PHYTOPLASMA INFECTIONS IN POTATO AND TOMATO PLANTS FROM DIFFERENT LOCATIONS IN TURKEY INTRODUCTION Phytoplasma of the stolbur group (16SrXII) are phloem limited, insect-transmitted pathogens and they infect a great number of plants species (Ember et al., 2011; Lee et al. 2000), and depending on the affected species this phytoplasma induce various systemic symptoms ranging from yellowing, shoot proliferation, witches’-broom growth to phyllody and virescence. In the last ten years, increasing incidence of stolbur phytoplasma was registered in different crops (grapevine, maize, sugar beet, potato, tomato, vegetable crops), suggesting its’ progressive spread. In the vegetable crops, severe yield losses caused by stolbur phytoplasma have been recorded in solanaceous crops (tomato, potato, pepper) and celery (Carraro et al., 2008; Navràtil et al., 2009; Fialova et al., 2009, Ember et al., 2011). Stolbur phytoplasma also has a wide host range that includes weeds from the families Asteraceae (Taraxacum officinale, Cirsium arvense), Convolvulaceae (Convolvulus arvensis) and Urticaceae (Urtica dioica), which can serve as pathogen reservoirs (Berger et al. 2009; Navràtil et al. 2009; Langer and Maixner 2004). Potatoes and tomatoes are considered among the most important crops in Turkey, as their total productions reach high levels (4,648,081 and 11.003.433 tons, respectively) (Anonymous, 2011). The presence of stolbur phytoplasma disease in potato and tomato fields of Turkey has been recorded (Özdemir et al., 2009), however not much is known regarding the molecular information of its’ genome. Accordingly, the first aim of this study is to investigate the etiology of diseased potato and tomato plants in four provinces in Turkey, Kayseri, Sivas, Kahramanmaraş, and Adana. Surveyed fields showed plants with leaf yellowing and rolling, reddish and purplish discoloration and presence of aerial tubers, whislt tomato plants exhibited flower malformations, phyllody and big bud, all symtpoms suspected to be of phytoplasmal origin. The second aim is to characterize at the molecula level the identified pathogen reponsible of the encountered diseases, for which the results are hereafter reported. MATERIALS AND METHODS Plant Material and Insects Sampling During August 2012, two lots of 20 samples each were collected from four locations, Kayseri/Sivas and Kahramanmaraş/Adana, dedicated to potato and tomato plantations, respectively. Samples consisted of leaves collected from plants showing typical symptoms of phytoplasma (Fig. 1 and 2) and from plants with apparent symptoms. The survey has also interested the collection of Cicadula inornata (Cicadellidae) insects that were found nourishing on infected plants. Insects were trapped with a D-Vac apparatus in tomato plots at Kahramanmaraş (Elbistan) province. Samples gathered from potatoes fields at Kayseri province were denoted “PoSKa2” and “PoSKa4”, from Sivas province as “PoSSi1” and “PoSSi5”, while samples gathered from tomatoes fields from Adana provinces were denoted “ToSAd1” and “ToSAd2”. Tomato samples and Cicadula inornata from tomato in Kahramanmaraş (Elbistan) were denoted “ToSEL1” and “ToSCi” respectively. All samples originated from plants and insects were subjected to molecular assays. DNA Extraction and Polymerase Chain Reaction Amplification (PCR) DNA was extracted from fresh leaves of symptomatic and asymptomatic tomato and potato plants as described by Ahrens and Seemüller (1992), with some modifications. Tissue samples (1 g) were homogenized in 4 ml of CTAB buffer (2% w/v cetyltrimethylammonium bromide, 1.4 M NaCl, 0.2% 2-β-mercaptoethanol, 20 mM EDTA, 100 mM Tris-HCl, 2% polyvinylpyrrolydone, pH 8.0) and 1.5 ml aliquots of the extract were incubated at 65°C for 30 min. DNA was further purified by phenol and chloroform-isoamyl alcohol (24:1) extraction and afterward precipitated. Eluted DNA template was used for direct PCR amplification. DNA was also extracted from cixiids according to Doyle and Doyle (1990). 2 B. K. ÇAĞLAR, T. ELBEAINO, M. KÜSEK, D. PEHLIVAN, H. FIDAN, M. PORTAKALDALI a b Figure 1. (a) Potato plants infected with stolbur phytoplasma and showing aerial tubers with severe deformation symptoms. (b) Tomato plants infected with stolbur phytoplasma and showing sepal hypertrophy symptoms. 1 2 3 4 5 6 7 8 9 10 11 1250 bp 1000 bp Figure 2. Electropherogram showing 16SrDNA nested-PCR products amplified with R16F2n/R16R2 from potato and tomato phytoplasmaaffected plants. Lane 1: 1 kb DNA marker; lane 2: PoSKa2; lane 3: PoSKa4; lane 4: PoSSi1; lane 5: PoSSi5; lane 6: ToSEL1; lane 7: ToSCi; lane 8: ToSAd1; lane 9: ToSAd2; lane 10: healthy potato plant; lane 11: healthy tomato plant. The universal phytoplasma primer pair R16F1/R16R0 (5'-AAGACGAGGATAACAGTTGG-3'/5'GGATACCTTGTTACGACTTAACCCC-3') (Lee et al., 1994) was used in one step PCR for amplifying a 1.8 kbp fragment of ribosomal operon consisting of the 16SrRNA gene, the 16S-23S intergenic spacer region (SR) and a portion of the 5’ region of 23SrRNA gene. A 1:100 dilution of the single step PCR product was used as template for 3 STOLBUR PHYTOPLASMA INFECTIONS IN POTATO AND TOMATO PLANTS FROM DIFFERENT LOCATIONS IN TURKEY the nested PCR round, utilizing the primer pair R16F2n/R16R2 (5'-ACGACTGCTAAGACTGG-3'/5'TGACGGGCGGTGTGTACAAACCCCG-3'), which amplify an internal DNA fragment of 1,250 bp from the 16SrRNA gene (Gunderson and Lee, 1996). For first step PCR, amplification was performed in 50 reaction mixtures, each containing 100 ng of extracted DNA, 1.25 μl dNTPs (10 mM), 1 μl forward and reverse primers (10 pmol), 10 μl of 5X Crimson Taq reaction buffer, 3 μl MgCl2 (25 mM) and 0.25 μl Crimson Taq DNA polymerase (5U/μl ) (BioLabs, USA). PCR was conducted in a Techne TC 4000 apparatus using the following parameters: 35 cycles of 1 min at 94 °C, 2 min at 50 °C and 3 min at 72 °C. PCR conditions for the second round (nested PCR) were the same, except for the annealing temperature that was at 58 °C. An extension cycle consisting of 10 min at 72 °C was used for both PCRs. 10 μl of PCR products primed with R16F2n/R16R2 were electrophoresed in 1% agarose gel in 1xTBE buffer (67 mM Tris-HCl, 22 mM boric acid, 10 mM EDTA, pH 0.8) together with 1 kb DNA marker (Fermentas, Milan, Italy), stained with ethidium bromide and photographed on a UV transilluminator. Restriction Fragment Length Polymorphism (RFLP) Analyses Restriction fragment length polymorphism (RFLP) analysis was performed using 100 ng of purified R16F2n/R16R2-primed nested-PCR amplicons products obtained from potato and tomato samples and reference stolbur strain. First RFLP was performed using EcoRI to distinguish between R16F2n/R16R2 PCR amplicon product of phytoplasma and chloroplast DNA of plants (Nejat et. al 2009). Amplicons were digested separately with 2 µl each of following restriction enzymes: TaqI at 65°C and MseI, AluI, HpaII, HhaI, RsaI at 37°C, according to manufacturer’s instruction (Fermentas, Milan, Italy). Fragments patterns were compared after electrophoresis on a 5% polyacrylamide gel followed by ethidium bromide staining, and photographed under UV at 312 nm using a transilluminator. Cloning, Sequencing and Phylogenetic Analysis The R16F2n/R16R2 primed-16S rDNA PCR products obtained from stolbur phytoplasma infected plants were excised from agarose gel, washed and eluted by centrifugation through siliconized glass wool, as described by Gromadka (1995). The eluted DNAs were sequenced from both directions using M13 forward and reverse sequencing-primers. DNA fragments were subjected to automated sequencing (ABI 3130xl Genetic Analyzer, Applied Bio. REFGEN Gen Araştırmaları ve Biyoteknoloji Ltd. Şti., Ankara, Turkey). Computer-assisted analysis of nucleotide sequences was assembled using the Strider 1.1 program (Marck, 1988). 16S-23S rDNA sequences of stolbur phytoplasma isolates with similar reference phytoplasmas were separately aligned using Clustal X 1.81 (Thompson et al., 1997). Phylogenetic tree was constructed using the NJ plot and Boostrap analysis with 1000 replicates using the NEIGHBOR methods of the PHYLIP package (Felsenstein, 1989). RESULTS Detection of Phytoplasma and Sequence Analysis The presence of phytoplasma was detected in 32, out of 40 tested, symptomatic potato and tomato plants (Fig. 1) resulting with an amplification of 1,250 bp DNA fragments using nested-PCR (Fig. 3). No PCR positive reactions were obtained from the eight asymptomatic plants tested. BLAST sequence analyses conducted on 20 different recombinant DNA clones, originated from 10 different infected plants of each species, showed that the 16SrDNA fragments amplified from potatoes and tomatoes plants share the highest identity (99.8%) with stolbur phytoplasma and in particular with the “Candidatus phytoplasma solani”, 16SrXII-A subgroup member, from Serbia (accession number: JQ730750) and Romania (accession number: HQ108388). All 16SrDNA phytoplasmal sequences of stolbur found in potato and tomato in Turkey were identical (100% homology) when compared between them. 4 B. K. ÇAĞLAR, T. ELBEAINO, M. KÜSEK, D. PEHLIVAN, H. FIDAN, M. PORTAKALDALI RFLP Analysis The presence of a single EcoRI restriction site in the 16F2n/R16R2- primed PCR products (1250 bp) generated a RFLP pattern made of two DNA fragments (750 bp and 500 bp), thus ascertaining the phytoplasmal nature of the nested-PCR amplicon (Figure 3). Performing separate digestions of PCR products with different endonucleases (EcoRI, TaqI, HhaI, AluI, MseI, RsaI and HpaII), all samples showed identical restriction profiles (Figure 3), thus indicating that a single phytoplasma infection has occurred in all affected plants. The RFLP profiles from stolbur phytoplasma isolates of Turkey and of that found in Cicadula inornata insects, were all similar to that of the reference strain, “Candidatus phytoplasma solani”, showing that there is no genetic variability within the Turkish isolates. EcoR I 1 2 3 4 5 6 Taq I 7 8 9 1 2 3 4 2 3 4 1 2 3 4 5 6 7 8 9 1 2 3 4 6 7 8 9 1 2 3 4 Mse I 5 6 7 8 9 6 7 8 9 6 7 8 9 Alu I Hha I 1 5 5 Rsa I 5 Hpa II 1 2 3 4 5 6 7 8 9 Figure 3. Electropherogram showing Restriction Fragment Length Polymorphisms of 16SrDNA, amplified by nested-PCR from diseased potato and tomato plants, using seven restriction enzymes (indicated above gels). Lane 1: 1 kb DNA marker; lane 2: PoSKa2; lane 3: PoSKa4; lane 4: PoSSi1; lane 5: PoSSi5; lane 6: ToSEL1; lane 7: ToSCi; lane 8: ToSAd1; lane 9: Tomato plant infected with “Candidatus phytoplasma solani” (16SrXII-A) used as reference control. 5 STOLBUR PHYTOPLASMA INFECTIONS IN POTATO AND TOMATO PLANTS FROM DIFFERENT LOCATIONS IN TURKEY 0.02 795 927 794 Acheloplasma laidlawii [M23932] PosKa2 Ca. phytplasma solani (XII-A) [JQ730750] ToSEL1 Ca. phytplasma solani (XII-A) [HQ108388] Ca. Phytoplasma solani (XII-A) [AF248959] ToSCi Strawberry lethal yellows phytoplasma (XII-C) [AJ243045] Ca. Phytoplasma australiense (VII-B) [L76865] 720 Ca. Phytoplasma caricae (XVII-A) [AY725234] Ca. Phytoplasma graminis (XVI-A) [AY725228] 653 Ca. Phytoplasma americanum (XVII-A) [Dq174122] Mexican periwinkle virescence phytoplasma (XIII-A) [AF248960] 1000 Clover phyllody phytoplasma (I-C) [AF189288] Aster yellows phytoplasma (I-F) [AY265211] 625 Blueberry stunt phytoplasma (I-E) [AY265213] Aster yellows phytoplasma (I-D) [AY265206] Derbid phytoplasma (XXVIII-A) [AY744945] 979 Buckland valley grapevine yellows phytoplasma (XXII-A) [AY083605] Sugarcane phytoplasma D3T2 (XXVII-A) [AJ539180] Sugarcane phytoplasma D3T1 (XXVI-A) [AJ539179] 932 1000 Ca. Phytoplasma cynodontis (XiV-A) [AJ550984) Ca. Phytoplasma oryzae (XI-A) [AB052873] 827 Ca. Phytoplasma pini (XXI-A) [AJ632155] Ca. Phytoplasma castaneae (XIX-A) [AB054986] Ca. Phytoplasma phoenicium (IX-D) [AF515636] Pigeonpea witches'-broom phytoplasma (IX-A) [AF248957] 1000 Loofah witches'-broom phytoplasma (VIII-A) [AF353090] Ca. Phytoplasma fraxini (VII-A) [AF092209] Ca. Phytoplasma trifolii (VI-A) [AY390261] 635 730 Alder yellows phytoplasma (V-C) [AY197642] 589 Ca. Phytoplasma ziziphi’-related strain JWB-Kor1 (V-G) [AB052879] 950 Ca. Phytoplasma ziziphi’-related strain JWB-G1 (V-B) [AB052876] Phytoplasma sp. Strain LDN (XXII-A) [Y14175] Sorghum bunchy shoot phytoplasma (XXIV-A) [AF509322] Coconut lethal yellowing phytoplasma (LYJ-C8) (IV-A) [AF498307] 804 Carludovica palmata leaf yellowing phytoplasma (IV-D) [AF237615] 1000 Phytoplasma sp. LfY5 (E65)-Oaxaca (IV-A) [AF500334] Weeping tea tree phytoplasma (XXV-A) [AF251672] Clover yellow edge phytoplasma (III-B) [AF189288] Western X phytoplasma (III-A) [L04682] 1000 993 Canadian peach X phytoplasma (III-A) [L33733] Ca. Phytoplasma brasiliense (XV-A) [AF147708] 991 Cactus witches'-broom phytoplasms (II-C) [AJ293216] Ca. Phytoplasma aurantifolia (II-B) [U15442] 1000 Ca. Phytoplasma australiense (II-D) [L76865] 983 Peanut witches'-broom phytoplasma (II-A) [L33765] Picris hieracioides phytoplasma (II-E) [JF799094] Picris echioides phyllody phytoplasma (II-E) [Y16393]_ Ca. Phytoplasma rhamni (XX-A) [X76431] Ca. Phytoplasma spartii (X-D) [X92869] 1000 Ca. Phytoplasma prunorum (X-F) [AJ542544] 929 995 Ca. Phytoplasma pyri (X-C) [AJ542543] 886 Ca. Phytoplasma mali (X-A) [AJ542541] Figure 4. Dendrogram, constructed by the neighbour-joining method, showing the phylogenetic relationship of stolbur phytoplasma from potato (Poska2), tomato (ToSEL1) and cixiid (ToSCi) of Turkey (in bold) and those present in database, based on 16S rRNA gene sequences. Groups and subgroups of phytoplasmas are reported between brackets ( ). GenBank accession numbers for sequences are reported between two braces [ ]. The reliability of the analysis was subjected to a bootstrap test with 1000 repeats. Bar, 0.01 nucleotide substitutions per site. Acheloplasma laidlawii was used as an outgroup species to root the tree. Phylogenetic Tree The phylogenetic tree constructed with 16SrDNA sequences of the stolbur phytoplasma of potato and tomato, together with members of 16SrXII-related subgroups, confirmed the RFLP results, hence placed the stolbur phytoplasma from Turkey in one subclade together with 16SrXII subgroups members (Figure 4). 6 B. K. ÇAĞLAR, T. ELBEAINO, M. KÜSEK, D. PEHLIVAN, H. FIDAN, M. PORTAKALDALI DISCUSSION In recent years, emerging phytoplasma diseases have increasingly become important in Turkey, due to the increment of plant material exchanging between agricultural districts and to the moderate weather that favors the multiplication of these pathogens and their insects-vectors. The molecular investigation carried out on samples collected from diseased potato and tomato plants, and originated from four different regions particularly dedicated to their production, showed the presence of a high level of phytoplasma infections; specifically with stolbur phytoplasma “Candidtus phytoplasma solani”, 16SrXII-A ribosomal subgroup member. The incidence of this phytoplasma in the surveyed field was somehow significant (80%), considering that 32 samples were PCR-positive out of 40 tested. The “Candidtus phytoplasma solani”, was previously reported in solanaceous crops in Turkey, however with a lower incidence (Sertkaya et al., 2007). Accordingly, quarantine measures should be taken in order to prevent the further expansion of this pathogen where potatoes and tomatoes are grown in the country. The molecular analysis conducted in this study showed that there is no notable sequence variation in the stolbur phytoplama found in both species. This result was also confirmed with the RFLP, sequencing and phylogeny analyses. An interesting outcome of this study was the identification of stolbur phytoplasma in Cicadula inornata insects (Cicadellidae); however, further experiments are needed to ascertain whether this phytoplasma is transmitted in nature by this novel insect. ÖZET TÜRKIYE'NIN DEĞIŞIK YÖRELERINDEN ALINAN PATATES VE DOMATES BITKILERINDE GÖRÜLEN STOLBUR PHYTOPLASMA ENFEKSIYONLARI Türkiye’nin dört farklı ilinde 2012 Ağustos ayı boyunca yapılan bir survey süresince patates (Solanum tuberosum L.) ve domates (Solanum lycopersycum L.) bitkilerinde fitoplasma kaynaklı hastalığın tanılanması ile ilgili bir çalışma yürütülmüştür. Kayseri ve Sivas illerinden kızarıklık, morarma gibi renk değişikliği ve yaprak kıvrılması simptomu gösteren patates bitki örnekleri, Kahramanmaraş ve Adana illerinden çiçek anormallikleri, çanak yaprak irileşmesi ve şişmesi simptomu gösteren domates bitki örnekleri toplanmıştır. Toplanan örnekler Polimeraz Zincir Reaksiyonu (PCR) yöntemi ile R16F1/R16R0 (universal) ve R16F2n/R16R2 (nested) primerler kullanılarak testlendiğinde, simptom gösteren bütün bitkiler pozitif reaksiyon vermiştir. Araştırmaya dahil edilen toplam 40 bitki örneğinden 32 simptomlu bitkide fitoplazma saptanırken, 8 simptomsuz bitkide fitoplazma saptanmamıştır. Domates ve patateslerde saptanan fitoplazmanın 16S rDNA’i üzerinden yapılan PCR sonucunda elde edilen PCR ürününün (1250 bp) baz dizilimi, “Candidatus phytoplama solani” (16SrXII-A ribosomal altgurub) ile %99.8 oranında benzerlik göstermiştir. Domates üretim alanlarından toplanan Cicadula inornata (Cicadellidae)’nın bünyesindeki fitoplazmanın, 16S rDNA’i üzerinde yapılan PCR ve genetik analizlerden de aynı sonuç elde edilmiştir. İzolatlar arasında genetik farklılıkların olup olmadığını kontrol etmek amacıyla PCR sonucunda elde edilen 1250 bp PCR ürünü EcoRI TaqI, HhaI, AluI, MseI, RsaI HpaII enzimleri kullanılarak RFLP çalışmasına dahil edilmiştir. RFLP sonuçlarında Candidatus phytoplasma solani ile aynı sonucu vermiştir. RFLP sonuçlarının ve genetik dizilimle elde edilmiş filogenetik ağacın uyum içerinde olduğu ve Türkiye’deki araştırmaya konu olan stolburun 16SrXII-A ribosomal altgruba ait olduğu ortaya konulmuştur. Çalışmada Kayseri, Sivas, Adana ve Kahramanmaraş illerindeki patates ve domateslerden saptanan fitoplazmaların tamamı benzer olarak bulunmuştur. Türkiye’deki üretim alanlarında Cicadula inornata’nın fitoplazma vektörü olup olmadığı konusunda da daha fazla araştırma gerekmektedir. Anahtar Kelimeler: 16S rRNA, PCR, RFLP, genetik dizilim ve filogenetik analiz LITERATURE CITED Ahrens, U., and Seemüller, E., 1992. Detection of DNA of plant pathogenic mycoplasmalike organisms by a polymerase chain reaction that amplifies a sequence of the 16S rRNA gene. Phytopathology, 82: 828-832. 7 STOLBUR PHYTOPLASMA INFECTIONS IN POTATO AND TOMATO PLANTS FROM DIFFERENT LOCATIONS IN TURKEY Anonymous, 2011. Crop production Statistic. Turkish Statistical Institute. Available at: http://www.tuik.gov.it. Berger J, Schweigkofler W, Kerschbamer C, Roschatt C, Dalla ViaJ, Baric S., 2009. Occurrence of Stolbur phytoplasma in the vector Hyalesthes obsoletus, herbaceous host plants and grapevine in South Tyrol (Northern Italy). Vitis 48:185–192. Carraro L, Ferrini F, Martini M, Ermacora P, Loi N., 2008. A serious epidemic of stolbur on celery. J Plant Pathol 90:131–135. Doyle, J.J. and J.L. Doyle, 1990. Isolation of plant DNA from fresh tissues. Focirs, 12: 13–15 Ember, I., Acs Z., Munyaneza, J. E., Crosslin, J. M., Kölber, M., 2011.- Survey and molecular detection of phytoplasmas associated with potato in Romania and Southern Russia.- European Journal of Plant Pathology, doi: 10.1007/s10658- 011-9759-5. Felsenstein, J., 1989. PHYLIP- phylogeny inference package (version 3.5). Cladistics, 5: 164–166 Fialova. R., Valova P., Balakishiyeva, G., Danet, J. L., Safarova, D., Foissac, X., Navratil, M., 2009.- Genetic variability of stolbur phytoplasma in annual crop and wild plant species in South Moravia.- Journal of Plant Pathology, 91(2): 411-416. Gromadka, R., 1995. Szybka izolacja DNA z agarozy. In: (ed. Techgen Sp. z.o.o), In_zynieria genetyczna i biologia molekularna. Metody, Podreczniki laboratoryjne IBB PAN, Warszawa. pp 6–7. Gundersen, D.E, Lee, I.M., 1996. Ultrasensitive detection of phytoplasmas by nested-PCR assays using two universal primer pairs. Phytopathol Mediterr 35:144–151. Langer M, Maixner M., 2004. Molecular characterization of grapevine yellows associated phytoplasmas of the stolbur-group based on RFLP-analysis of non-ribosomal DNA.Vitis 43:191–199. Lee, I.-M., Gundersen, D. E., Hammond, R. W., Davis, R. E., 1994. Use of mycoplasmalike organism (MLO) group-specific oligonucleotide primers for nested-PCR assays to detect mixed- MLO infections in a single host plant. Phytopathology 84, 559– 566. Lee, I. M., Davies, R. E., and Gundersen-Rindal, D. E., 2000. Phytoplasma: Phytopathogenic mollicutes. Annu. Rev. Microbiol. 54:221-255. Navratil M, Va´ lova´ P, Fialova´ R, Lauterer P, Sˇ afa´ rˇova´ D, Stary´ M., 2009. Incidence of stolbur disease in vegetable crops in South Moravia (Czech Republic) and consequences of yield losses. Crop Prot 28:898–904. Nejat, N., K. Sijam, S.N.A. Abdullah, G. Vadamalai and M. Dickinson, 2009. First report of a 16SrXIV, ‘Candidatus phytoplasma cynodontis’ group phytoplasma associated with coconut yellow decline in Malaysia. Plant Pathol., 58: 389. Özdemir N., Saygili H., Sahin F., Karsavuran Y., Bayrak O.F. and Oral B., 2009. Host range and genetic characterization of a phytoplasma causing tomato stolbur disease in Turkey. Proc. IInd Intl. Symposium on tomato diseases. Acta Hort. 808, ISHS 2009: 255-261. Sertkaya G., Martini M., Musetti R, Ruggero O., 2007. Detection and molecular characterization of phytoplasmas infecting sesame and solanaceous crops in Turkey. Bulletin of Insectology 60 (2): 141-142, 2007. Thompson, J.D., T.J. Gibson, F. Plewniak, F. Jeanmougin and D.G. Higgins, 1997. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucl. Acids Res., 24: 4876–4882. 8 J. Turk. Phytopath., Vol. 39 No. 1-3, 9-18, 2010 ISSN 0378 - 8024 Solanapyrones Produced by Turkish Isolates of Ascochyta rabiei and Their Phytotoxicity on Chickpeas Muharrem TÜRKKAN*, Fatma Sara DOLAR** * Department of Plant Protection, Faculty of Agriculture, University of Ordu, 52200, Ordu, Turkey, ** Department of Plant Protection, Faculty of Agriculture, University of Ankara, 06110, Ankara, Turkey, Accepted for publication February 10, 2013 ABSTRACT Randomly selected four isolates were grown on Czapek Dox liquid medium supplemented with metal cations for 7, 14 and 21 days in order to determine kinetics of solanapyrones production during in vitro growth of Turkish isolates of Ascochyta rabiei. After culture filtrates were passed through the C18 cartridge, the solanapyrones were eluted with 2 ml acetonitrile. Quantitation of solanapyrones was determined with LC/MS analyses. Maximum solanapyrones production of the isolates was observed on 14th day of incubation. Therefore, quantitation of solanapyrones of the rest 63 isolates of A. rabiei was also determined on the 14th day. Of the 67 A. rabiei isolates used in the present study, it was determined that 66 (98.5 %) isolates produced solanapyrone A, 18 (26.9 %) isolates produced solanapyrone B and 64 (95.5 %) isolates produced solanapyrone C. Toxicity of solanapyrones on both sensitive (ILC 1929) and resistant (ILC 3279) chickpea cultivars were demonstrated by the living cell bioassay. The LD50 concentrations for solanapyrone A, B and C in the bioassay for the sensitive cultivars were respectively 18.6, 23.2 and 96.8 µg/ml while those for the resistant cultivars were respectively 34.5, 36.2 and 109.3 µg/ml. The LD50 concentrations of the mix of solanapyrones in the sensitive and resistant cultivars were respectively 42.4 and 45.4 µg/ml. Keywords: Ascochyta rabiei, Pathotype, Chickpea, Solanapyrones, Bioassay INTRODUCTION Chickpea (Cicer arietinum L.) is one of the most extensively grown legume crops in Turkey. According to FAO records in 2010, total plantation of chickpea is 446218 hectares, production is 530634 tones and rate of yield is 1189 kg hectare-1 in Turkey (FAOSTAT, 2012). Chickpea production and quality are negatively affected by a number of biotic and abiotic stresses (Singh et al., 1994). One of the greatest biotic stresses reducing potential yield in chickpea is Ascochyta blight caused by Ascochyta rabiei (Pass.) Lab. (Singh and Reddy, 1996). A. rabiei is a heterotallic Ascomycete with two mating types, and both mating types are present in most chickpea production areas (Trapero-Casas and Kaiser, 1992; Kaiser and Kusmenoğlu, 1997). Pathogenic variability of A. rabiei is enhanced by the presence of the teleomorphic stage (Kaiser, 1997), which has been reported from almost all chickpea producing countries in the world (Udupa and Weigand, 1997; Jamil et al., 2000; Maden et al., 2004; Chen et al., 2004; Chongo et al., 2004; Türkkan and Dolar, 2009). A. rabiei attacks all above-ground parts of plants and causes necrotic lesions which are circular on leaves and pods and elongate on petioles and stems. When stems and petioles are girdled, they usually break (Nene and Reddy, 1987). The disease may cause total yield loss if the enviromental conditions are favorable (Singh and Reddy, 1990). Phytotoxins are known to be secreted by a number of phytopathogenic fungi (Durbin, 1981). It is thought that these toxins are playing an important role in plant diseases, because they can induce most or all of the disease symptoms (Yoder, 1980; Strobel, 1982). It is known that early symptoms of A. rabiei causes epinasty and loss of turgor in petioles and young branches (Alam et al. 1989). Later, the whole aerial part of the plant may dry out and die. Solanapyrone toxins (A and C) in culture filtrates of A. rabiei firstly determined by Alam et al. (1989). After 9 SOLANAPYRONES PRODUCED BY TURKISH ISOLATES OF ASCOCHYTA RABIEI AND THEIR PHYTOTOXICITY ON CHICKPEAS Chen et al. (1991) optimized solvent system for seperation of solanapyrones, solanapyrone B was also found in culture filtrate of the fungus. In further studies, the workers reported that production of solanapyrone toxins varied according to content of the liquid culture medium on which the fungus was grown (Chen and Strange, 1991; Höhl et al., 1991; Latif et al., 1993; Kaur, 1995; Bahti and Strange, 2004). Application of solanapyrone toxins were reported to led to morphological changes in chickpea leaves and caused brekage in chickpea stem (Höhl et al., 1991; Hamid and Strange, 2000). Moreover, Höhl et al. (1991) observed that 100 and 200 µM concentrations of solanapyrone toxins caused a pronounced bleaching of the chlorophyll in the area of droplet application on leaves. Therefore, it was suggested that such symptoms could result from solanapyrones which were synthesized by A. rabiei. Zerroug et al. (2007) determined that 250 μM (75.5 μg ml-1) concentration of solanapyrone A inhibited the root growth of chickpea seedlings by 50%. Hamid and Strange (2000) reported that bleaching of the stem occurred and shoots of chickpea broke just below the uppermost leaf after application of 45.3 µg solanapyrone A. Moreover, they determined that LD50 values of solanapyrone toxins varied widely depending on cultivar and solanapyrone A was the most toxic of the three solanapyrones. The present study was carried out to determine the presence of the solanapyrone toxins in Turkish isolates of A. rabiei and toxicity of solanapyrones on both sensitive (ILC 1929) and resistant (ILC 3279) chickpea cultivars. MATERIALS AND METHODS Growth, spore production and storage of Ascochyta rabiei Totally sixty-seven isolates of A. rabiei, sixty-four of which were obtained from the culture collection of the Department of Plant Protection, Faculty of Agriculture, University of Ankara, were used in this study. The rest of the isolates representing the pathotypes of A. rabiei were provided by Dr. Bassam Bayaa from ICARDA. The isolates maintained on microbank were grown on CSMDA (Chikpea Seed Meal Dextrose Agar: chickpea meal 40 g, dextrose 20 g, agar 20 g, distilled water 1L) for 14 days at 22 ± 1 oC with a 12 h light-photoperiod. The cultures were flooded with sterile distilled water (SDW) and spores were scraped with sterile glass spatula. After the spores were filtered through filter paper to remove mycelial fragments, they were centrifuged at 10000xg/rpm for 10 min. They were resuspended in SDW and centrifuged twice more before finally resuspending them at 1×107 spores/ml. They were stored as a final suspension in 10% glycerol at -80 oC for use in the future experiments. Toxin Production A. rabiei isolates were grown on Czapek Dox medium supplemented with metal cations (ZnSO4.7H2O, 0.05 g l-1, CaCI2.2H2O, 0.1 g l-1, CuCI2.2H2O, 0.02 g l-1, CoCI2.6H2O, 0.02 g l-1, MnCI2.4H2O, 0.02 g l-1) (Hamid and Strange, 2000). The medium was dispensed in 250 ml Erlenmeyer flasks containing 30 ml Czapek Dox medium. Each flask was inoculated with 30 µl spor suspension of A. rabiei (107 spores ml-1). Flasks were incubated at 20 ± 1 oC without shaking. Fungal mycelia and spores were removed by filtration through Whatman No. 1 filtrate paper, 7, 14 and 21 days after incubation. Mycelial mass was dried at 70 oC until constant weight (UNB 500 Oven – 108 lt, “Memmert GmbH + Co. KG”, Germany). Solid phase extaction cartridges (SPE; 1 g C18, end-capped Isolute, Alltech Chromatography, USA) were conditioned with methanol (MeOH) (HPLC grade) (5 ml) and then distilled water (5 ml). Culture filtrates (10 ml) were passed through the column, and after washing with distilled water (5 ml), the toxins were eluted with 2 ml acetonitrile (ACN) (HPLC grade) and stored at -20 oC until required (Bahti and Strange, 2004). LC/MS Analysis The LC analyses for the screening and quantitation of solanapyrone A, B, and C were performed by an Agilent 1100 HPLC system (Waldbronn, Germany) with Agilent 1100 MS detector equipped with ESI interface. The analytical separation was performed on a ACE 5 C18 (150 x 4.6 mm, 5 µm) using the isocratic mixture of 0.01 mM acetic acid in 0.2% aqueous solution of formic acid [A] and acetonitril [B], [A:B] (50:50; v:v) at a flow rate of 0.8 ml min-1. MS data acquisition was obtained with positive and negative-ion detection in selected ion monitoring (SIM) mode. 10 M. TÜRKKAN, F. S. DOLAR Growth of chickpeas for bioassay study Chickpea plants consisting of ILC 1929 (susceptible) and ILC 3279 (resistant) were used in bioassay studies. The seeds were surface sterilized with sodium hypochloride (1%) for 3 min, then washed with sterile distilled water (SDW) for 3 times and, they were sown in 14 cm pots containing sterilized mixtures of soil, sand and fertilizer (1:1:0.5, v/v/v). Plants were grown at 22 ± 1 °C with a 14 h light-photoperiod (light intensity, 260 µmoles sec-1 m-2) for 14 day. Bioassay Solanapyrone A, B, C and the mix of solanapyrones (1:0.1:1) were predissolved in MeOH and then diluted in Czapek Dox containing 5% dimethyl sulfoxide (DMSO) to yield concentration of 250, 125, 62.5, 31.3, 15.6, 7.8 and 3.9 µM. Living cell bioassay Living cell bioassay was performed using the method developed by Shohet and Strange (1989). Chickpea plants were watered 30 min prior to cell isolation. Leaflets excised from chickpea plants were cut into small pieces and vacum infiltreted with an enzyme cocktail solution. The enzyme cocktail solution consisted of Cellulase R10, 200 mg (Sigma Aldrich Co., USA); Macerozyme R10, 30 mg (Sigma Aldrich Chemie, Germany) and bovine serum albumin, 5 mg (BSA, Sigma Aldrich Chemie, Germany) in 10 ml of a holding buffer consisting of citric acid monohydrate, 10.5 g l-1; CaCl2.2H2O, 5 mM; K2HPO4, 1 mM; Mg(SO4)2.7H2O, 1 mM; glucose, 100 g l-1; NaOH, 6.2 g l-1, adjusted to pH 5.8 with HCl 0.1 M). The suspension of leaflets in the digestion solution was stirred on a magnetic stirrer at 120 rpm for 20 min. The suspension was filtered through four layers of muslin and then washed three times by centrifuging at 750 rpm for 5 min in the holding buffer. Cell viability was checked by vital staining with fluorescein diacetate (FDA). Solutions at different concentrations of solanapyrones were placed in wells of microtest plates (50 µl/well), and 50 µl of cell suspension was transferred into each well. After cells were incubated at 25 °C for 3 h in the dark, the cells were stained with FDA. Then, 30 µl of cell suspension was transferred onto a microscope slide, and the viability of 50 cells was assessed under a fluorescence microscope (cells with intact plasma membranes fluoresced yellowgreen, while dead cells remained unstained). The LD50 values extracted from graphs of probit percent cell death corrected for control values. The experiment was carried out with three replicates. RESULTS AND DISCUSSION A number of pathogenic fungi produce one or more toxic metobolites which are injurious to plants (Durbin, 1981). It is thought that these toxins are playing an important role in plant diseases, because they can induce most or all of the disease symptoms (Yoder, 1980; Strobel, 1982). Ascochyta rabiei which produces solanapyrone A, B and C as well as chytochalasin D in liquid culture medium causes epinasty and loss of turgor in petioles and young branches on chickpea (Alam et al., 1989; Höhl et al., 1991; Latif et al., 1993). Conventionally, solanapyrone toxins have been determined by HPLC which is based on C18 silica column separation with ACN/water (1:1) mobile phase with UV detection (Chen et al., 1991). As has been reported by other researchers, solanapyrone A was also well separated with UV detection in our study (Chen et al., 1991; Kaur, 1995). However, solanapyone B and C was coeluted so that they had the same retention time (Figure 1a). This method was not sufficiently separated solanapyrones for quantitative analysis and need optimization (Chen et al., 1991). Therefore, solanapyrone A and C toxins were firstly reported from liquid culture filtrate of A. rabiei, but solanapyrone B was not determined in culture filtrate of the fungus (Alam et al., 1989). After application of solvent optimization to the separation of solanapyrones toxins, all three solanapyrone A, B and C was isolated from A. rabiei (Chen et al., 1991). However, solvent optimization is still limited owing to the difficulty of monitoring the crossing over of peaks in different solvents and the large number of variables which affect the separation (Synder and Kirkland, 1979). The determination and quantification of solanapyrones in the culture filtrate of A. rabiei was carried out with chromatography (TLC, HPLC, MS and 1H-NMR) (Höhl et al., 1991). In our study, therefore, the amounts of solanapyrone A, B and C in the culture filtrates of sixty-seven A. rabiei isolates were determined by HPLC\MS 11 SOLANAPYRONES PRODUCED BY TURKISH ISOLATES OF ASCOCHYTA RABIEI AND THEIR PHYTOTOXICITY ON CHICKPEAS analyses. After chromatographing toxins by HPLC using a diode array detector (DAD), UV spectral data of the solanapyrone standarts were obtained (Table 1; Fig. 1). The retention time of solanapyrone A, B and C standards were approximately 11.39, 10.06 and 10.11 min, respectively. Detection was carried out with ESI-MS in SIM mode. Molecular ions selected for quantification of toxins in samples were 303 (positive ion), 287 (positive ion) and 331 (negative ion) for solanapyrone A, B and C, respectively (Fig. 1b, c and d). Figure 1. Shows UV and LCMS separation of solanapyrones a) separation of solanapyrone A,B and C by DAD; separation of solanapyrone A (b), B (c) and C (d) by MS 12 M. TÜRKKAN, F. S. DOLAR In order to determine kinetics of the solanapyrones production during in vitro growth of Turkish isolates of A. rabiei, randomly selected four isolates were grown on Czapek Dox liquid medium supplemented with metal cations for 7, 14 and 21 days under continuous light. It is observed that solanapyrones production of the isolates varied considerably during three different incubation periods (Table 2). In the 7th day, production of each three solanapyrones was in very low quantity. The amount of solanapyrone C and B in liquid culture was higher than that of solanapyrone A on this incubation period. Similarly, Höhl et al. (1991) reported that the major toxin in fluids of germinating spores was solanapyrone C, and solanapyrone B was detected in trace amount on the 4th day along with solanapyrone C. In the same period, they did not found solanapyrone A in culture filtrate and it was observed after 6th day of incubation. Results of our study showed that the concentration of solanapyrone A and C in culture filtrates of four isolates (except for solanapyrone C production of isolate Ank-3) reached the highest quantity on the 14th day. This result is in agreement with previous studies reporting that the concentration of solanapyrone A in the culture filtrates peaked at 14-16 day (Bahti and Strange, 2004; Zerroug et al., 2007). In the present study, however, solanapyrone B could not be detected in the culture filtrate of the isolates on the 14th day. In following incubation period, solanapyrone toxins in the fungal culture rapidly decreased. As mentioned by previous researchers, these results show that production of solanapyrone toxins are limited to a certain stage of growth cycle and can imply that the increase of mycelial mass of the fungi is closely related with the quantity of solanapyrones (Höhl et al., 1991; Chen and Strange, 1991; Kaur, 1995). In our main study, therefore, 14th day of incubation was used for extraction of the rest 63 isolates of A. rabiei. The amounts of solanapyrone A, B and C of all 67 isolates were shown in Table 3. Although solanapyrone B in culture filtrates of all four isolates in previous study limited to 7th day of the incubation periods, we determined that 18 A. rabiei isolates out of 67 produced solanapyrone B on 14th day in the following study. Except for isolate Ank-9, Solanapyrone B quantity of these isolates was also very low compared to the other solanapyrones. Höhl et al. (1991) detected that the concentration of sugar in liquid culture medium especially affected the amount of solanapyrone B whereas solanapyrone A and C remained unaffected. The amount of solanapyrone A and C also varied according to isolates and 64 A. rabiei isolates produced both solanapyrone A and C. These toxins weren’t detected in culture filtrate of isolate Kay-2. All other isolates produced solanapyrone A and solanapyrone C and they were determined in culture filtrates of 64 A. rabiei isolates, except Kay-2, Ams-2 and PII. Table 1. UV data for solanapyrone A, B and C Solanapyrone A λmax: 231, 326 nm Solanapyrone B λmax: 200, 302 nm Solanapyrone C λmax: 237, 317 nm Table 2. The amounts of solanapyrone A, B and C in the mycelial dry weight (g) of four Ascochyta rabiei isolates Names of the isolates Afy-1 Dez-5 Ank-3 Kmar-1 Incubation periods (day) 7 14 21 7 14 21 7 14 21 7 14 21 A 0.09 15.79 0.13 7.16 0.35 0.08 38.8 0.90 0.12 6.22 1.73 Solanapyrone (µg/g) B C 1.47 1.29 9.41 0.82 0.28 0.78 19.72 9.78 0.4 1.12 0.05 4.27 0.93 1.50 14.96 1.79 13 SOLANAPYRONES PRODUCED BY TURKISH ISOLATES OF ASCOCHYTA RABIEI AND THEIR PHYTOTOXICITY ON CHICKPEAS Table 3. The solanapyrone production of sixty seven isolates of Ascochyta rabiei Name of the isolates 14 Solanapyrone (µg/g the mycelial dry weight) Pathotypes** A B C Total *Pathotype I 22.2 - 4.23 26.43 Ady-1 14.43 - 7.39 21.82 I Ady-2 45.88 - 70.0 115.88 I I I Ady-3 1.03 - 9.50 10.53 Ady-4 28.92 1.08 80.00 110.00 I Ady-5 86.67 - 102.5 189.17 I Ady-6 97.84 - 107.3 205.14 I Afy-1 15.79 - 9.41 25.20 I Ams-1 3.97 - 18.26 22.23 I Ams-2 0.13 - - 0.13 I Ank-1 0.84 - 0.95 1.79 I Ank-2 90.94 - 124.06 215.00 I Ank-3 38.80 - 0.05 38.85 I Ank-4 11.8 - 40.82 52.62 I Ank-5 47.44 - 101.86 149.30 I Ant-1 5.66 0.08 0.23 5.97 I Ant-2 7.35 - 4.51 11.86 I Ant-3 57.20 - 39.56 96.76 I Çor-1 16.29 0.14 22.77 39.20 I Çor-2 24.40 0.26 21.76 46.42 I Çor-3 83.13 2.50 186.56 272.19 I Dez-1 0.510 - 10.02 10.53 I Dez-2 49.10 0.33 83.08 132.51 I Diy-1 20.74 - 59.26 80.00 I Diy-2 5.16 - 58.39 63.55 I Diy-3 56.47 - 121.18 177.65 I Esk-1 0.75 - 33.40 34.15 I Esk-2 93.55 - 91.29 184.84 I Esk-3 15.81 - 106.13 121.94 I Esk-4 16.36 1.09 39.45 56.90 I Kmar-1 6.22 - 14.96 21.18 I Kay-1 10.17 - 9.87 20.04 I Kır-1 18.30 5.11 28.3 51.71 I Kır-2 0.88 - 5.33 6.21 I Tok-1 46.50 - 63.00 109.5 I Uşk-1 2.28 0.15 21.02 23.45 I Uşk-2 11.47 - 13.53 25.00 I I Uşk-3 16.74 - 14.91 31.65 Yoz-1 11.61 - 3.94 15.55 I *Pathotype II 9.84 0.05 - 9.89 II II Dez-3 12.61 - 174.78 187.39 Kay-2 - 0.08 - 0.08 II Urf-1 38.52 - 61.85 100.37 II M. TÜRKKAN, F. S. DOLAR *Pathotype III Ady-7 Ady-8 Ams-3 Ams-4 Ank-7 Ank-6 Ank-8 Ank-9 Bur-1 Çor-4 Dez-4 Dez-5 Dez-6 Dez-7 Diy-4 Diy-5 Diy-6 Diy-7 Siv-1 Uşk-4 Uşk-5 Yoz-2 Yoz-3 27.05 9.38 16.82 0.05 13.34 43.20 23.93 20.57 13.85 26.15 43.19 0.22 7.16 24.36 9.80 52.41 10.52 2.72 5.46 3.92 14.55 4.10 34.68 5.44 0.11 0.10 0.16 41.54 0.11 0.08 0.07 - 12.28 5.71 3.41 0.28 44.84 34.33 3.03 20.53 133.08 361.54 69.86 15.43 19.72 18.05 100.40 66.55 4.16 13.97 12.20 22.94 47.27 22.37 80.96 26.83 39.33 15.20 20.23 0.43 58.18 77.69 26.96 41.1 188.47 387.69 113.05 15.65 26.88 42.41 110.20 118.96 14.79 16.69 17.74 26.86 61.82 26.47 115.71 32.27 III III III III III III III III III III III III III III III III III III III III III III III III * Referans pathotypes of A. rabiei were provided by Dr. Bassam Baya. ** Türkkan and Dolar (2009) These results are in agreement with studies of Chen and Strange (1991), who reported that each three solanapyrones were produced by A. rabiei when it is grown on Czapek Dox medium supplemented with metal cations. Pathogenic variability among isolates of A. rabiei has been reported from almost all chickpea producing countries in the world including India, USA, Syria, Pakistan, Turkey and Canada. The isolates used in these studies have been classified into 3 to 17 pathotypes based on their reactions on 3 to 16 host genotypes (Udupa and Weigand, 1997; Jamil et al., 2000; Maden et al., 2004; Chen et al., 2004; Chongo et al., 2004). Recently, Türkkan and Dolar (2009) categorized 64 A. rabiei isolates into three pathotypes based on differences in aggressiveness on three differential chickpea cultivars (ILC 1929, ILC 482 and ILC 3279). Pathotype I was the least agressive pathotype, whereas pathotype III was the most agressive pathotype. Because the same isolates were used in present study, we could compare solanapyrone production among all three pathotypes. Although solanapyrones production of some of pathotype I isolates was very low in liquid culture medium, the others’ was very high. Moreover, higher amounts of solanapyrone toxins were not isolated from the more aggressive isolates of pathotype II and III. For example, solanapyrones production of isolates Kay-2 and Ams-3 which are belonging to PII and PIII, respectively was very low. Results of our study therefore showed that there were not a correlation between pathotypes of A. rabiei isolates and their solanapyrone production in vitro conditions. Similar results were observed by Latif et al. (1998), who determined that the isolates produced significant levels of the solanapyrones in vitro growth and also induced significant levels of phytotoxic compounds in fungus infected plants caused a moderate degree of disease severity. Therefore, they reported that production of phytotoxic compounds had no bearing on the disease severity or fungal virulence because of the discrepancy in the levels of production of toxins during in vitro and in vivo situations. Sugawara and Strobel (1987) reported that a phytotoxin involved in a host–parasite interaction should be demonstrable in susceptible host plants after infection. Although Shahid and Riazuddin (1998) suggested that solanapyrone C has been found in field infected plants, other researchers could not detect any of solanapyrone toxins in chickpea tissue infected by the fungus (Höhl et al., 1991; Hamid and Strange, 2000; Bahti and Strange, 2004). However, they reported that application of the different toxin concentrations to chickpea plants led to morphological changes in both leaf and stem structures that are well comparable to those observed in the tissue of chickpea plants when invaded by the fungus. Therefore, it is argued that solanapyrones isolated from 15 SOLANAPYRONES PRODUCED BY TURKISH ISOLATES OF ASCOCHYTA RABIEI AND THEIR PHYTOTOXICITY ON CHICKPEAS A. rabiei may contribute to virulence or may be necessary for pathogenicity owing to their affects on chickpea plants (Alam et al., 1989; Höhl et al., 1991; Latif et al., 1993; Hamid and Strange, 2000). In our study, the effects of solanapyrone toxins on both susceptible and resistant chickpeas were determined with a living cell bioassay. It was found that solanapyrone A (18.6 and 34.5 µg ml-1 LD50 values for susceptible and resistant cultivars, respectively) was more toxic than solanapyrone B (23.2 and 36.2 µg ml-1) and C (96.8 and 109.3 µg ml-1) on each two chickpea cells as well as the mix of solanapyrone A, B and C (42.4 and 45.4 µg ml-1). This result is in agreement with previous studies, reporting that LD50 values of solanapyrone toxins varied widely depending on cultivar and solanapyrone A was the most toxic of all the three solanapyrones (Hamid and Strange, 2000). Morover, the researchers reported that the effect of solanapyrone A, B and C on cells isolated from chickpea was additive rather than synergistic (Alam et al., 1989; Höhl et al., 1991; Latif et al., 1993). ÖZET ASCOCHYTA RABİEİ’NİN TÜRK İZOLATLARININ SOLANAPYRONE ÜRETİMİ VE NOHUTLAR ÜZERİNDEKİ FİTOTOKSİTELERİ Ascochyta rabiei izolatlarının solanapyrone A, B ve C üretim kinetiğini belirlemek amacıyla rastgele seçilmiş 4 izolat 7, 14 ve 21 gün süreyle inorganik tuzlarla zenginleştirilmiş Czapek Dox sıvı besin ortamında geliştirilmiştir. Kültür fitratları C18 isolute kartijlerinden geçirildikten sonra solanapyrone toksinleri 2 ml acetonitril ile elute edilmiştir. Toksinlerinin kantitatif miktarları LC/MS ile belirlenmiştir. İzolatların solanapyrone A, B ve C üretiminin maksimum olduğu inkübasyon periyodunun 14. gün olduğu belirlenmiştir. Bu nedenle geri kalan 63 izolatın solanapyrone A, B ve C miktarları inkübasyonun 14. günü esas alınarak belirlenmiştir. Çalışmada kullanılan izolatların 66 (% 98.5)’ sının solanapyrone A, 18 (% 26.9)’ inin solanapyrone B ve 64 (% 95.5)’ ünün solanapyrone C ürettiği belirlenmiştir. Solanapyrone toksinlerinin toksisitesi hassas ve dayanıklı bitkilerde canlı hücre bioassay çalışmaları ile belirlenmiştir. Solanapyrone A, B ve C’ nin hassas çeşit ILC 1929’ da LD50 değerleri sırasıyla 18.6, 23.2 ve 96.8 µg ml-1 iken dayanıklı çeşit ILC 3279’ da sırasıyla 34.5, 36.2 ve 109.3 µg ml-1’ dir. Hassas ve dayanıklı çeşitlerde solanapyrone toksinlerinin karışımının LD50 konsantrasyonları sırasıyla 42.4 ve 45.4 µg ml-1’dir. Anahtar Sözcükler: Ascochyta rabiei, Pathotype, Chickpea, Solanapyrones, Bioassay ACKNOWLEDGEMENTS We are thankful to Dr. Estelle GEWİS (University College of London, UK) and Dr. Hideaki OİKAWA (University of Hokkaido, Japan) for providing solanapyrone standarts, and Dr. Bassam Bayaa for providing reference pathotypes of A. rabiei and chickpeas cultivars (ICARDA). We would also like to thank the Scientific & Technological Research Council of Turkey (Project no: 104O115). LITERATURE CITED Alam, S. S., Bilton, J. N., and Slawin, A. M. Z. 1989. Chickpea blight – production of the phytotoxins solanapyrone A and C by Ascochyta rabiei. Phytochemistry 28: 2627–2631. Bahti, P., And Strange, R. N. 2004. Chemical and biochemical reactions of solanapyrone A, a toxin from the chickpea pathogen, Ascochyta rabiei (Pass.) Labr. Physiological and Molecular Plant Pathology 64: 9–15. Chen, Y. M., Peh, E. K., And Strange, R. N. 1991. Application of solvent optimisation to the separation of the phytotoxins, solanapyrones A, B and C from culture filtrates of Ascohyta rabiei. Bioseparation 2: 107–113. Chen, Y. M., And Strange, R. N. 1991. Synthesis of the solanapyrones phytotoxin by Ascohyta rabiei in responce the metal cations and development of a defined medium for toxin production. Plant Pathology 40: 401–407. 16 M. TÜRKKAN, F. S. DOLAR Chen, W., Coyne, C. J., Peever, T. L., And Muehlbauer, F. J. 2004. Characterization of chickpea differentials for pathogenicity assay of ascochyta blight and identification of chickpea accessions resistant to Didymella rabiei. Plant Pathology 53: 759-769. Chongo, G., Gossen, B.D., Buchwaldt, L., Adhikari T. And Rimmer, S.R. 2004. Genetic diversity of Ascochyta rabiei in Canada. Plant Disease. 88: 4-10. Durbin, R. D. 1981. In: Toxin in plant disease. Academic Pres. New York, 515p. FAOSTAT, 2012. <http://faostat.fao.org/site/567/DesktopDefault.aspx?PageID= 567#ancor> [accessed 10 12 2012] Hamid, K., and STRANGE, R. N. 2000. Phytotoxicity of solanapyrones A and B produced by the chickpea pathogen Ascochyta rabiei and the apparent metabolism of solanapyrone A by chickpea tissues. Physiological and Molecular Plant Pathology 56: 235–244. Höhl, B., Weidermann, C., Höhl, U., And Barz, W. 1991. Isolation of solanapyrones A, B and C from culture filtrates and germination fluids of Ascochyta rabiei and aspects of phytotoxin action. Journal of Phytopathology 132: 193–206. Jamil, F. F., Sarwar, N., Sarwar, M., Khan, J. A., Geistlinger, J., And Kahl, G. 2000. Genetic and pathogenic diversity within Ascochyta rabiei (Pass.) Lab. populations in Pakistan causing blight of chickpea (Cicer arietinum L.). Physiological and Molecular Plant Pathology 57: 243-254. Kaiser, W. J. 1997. Inter and intranational spread of ascochyta pathogens of chickpea, faba bean and lentil. Canadian Journal of Plant Pathology 19: 215-224. Kaiser, W. J., and Küsmenoglu, I. 1997. Distribution of mating types and the teleomorph of Ascochyta rabiei on chickpea in Turkey. Plant Disease 81(11): 1284-1287. Kaur, S. 1995. Phytoxicity of solanapyrones produced by the fungus Ascochyta rabiei and their possible role in blight of chickpea (Cicer arietinum L.). Plant Science 109: 23–29. Latif, Z., Strange, R. N., Bilton, J., And Riazuddin, S. 1993. Production of phytotoxins, solanapyrone A and C and cytochalasin D among nine isolates of Ascochyta rabiei. Plant Pathology 42: 172–180. Latif, Z., Shahid, A. A., And Riazuddin, S. 1998. Production of phytotoxins in chickpea plants with infected Ascochyta rabiei. Pakistan Journal of Biochemistry and Molecular Biology 31: 48-60. Maden, S., Dolar, F. S., Babaliogullu, I., Bayraktar, H., And Demirci, F. 2004. Determination of pathogenic variability of Ascochyta rabiei and reactions of chickpea cultivars against the pathotypes in Turkey. 5th European Conference on Grain Legumes Handbook, 7-11 June, Dijon, France, p. 307. Nene, Y. L., And Reddy M. V. 1987. Chickpea diseases and their control. The chickpea, Saxena M. C., Singh K. B. (eds),. Oxon, UK, p. 99–125. Shahid, A. A., And Riazuddin, S. 1998. Presence of solanapyrone C in blight infected chickpea plants. International Chickpea and Pigeon pea News Letter 5: 15–16. Shohet, S. And Strange, R. N., 1989. Use of isolated cells and protoplast to detect phytotoxic activity in cultures of Phytophthora drechsleri f.sp. cajani. Physiological and Molecular Plant Pathology, 34: 345-359. Singh, G., And Reddy, M. V. 1990. Pattern of resistance and susceptibility to races of Ascochyta rabiei amoung germ plasm accessions and breeding lines of chickpea. Plant Disease 74: 127–129. Singh, K. B., Malhotra, R. S., Halila, H., Knights, E. J., And Verma, M. M. 1994. Current status and future strategy in breeding chickpea for resistance to bitotic and abiotic stresses. Euphytica 73: 137-149. Singh, K. B., And Reddy, M. V. 1996. Improving chickpea yield by incorporating resistance to Ascochyta blight. Theoretical and Applied Genetics 92: 509-515. Strobel, G. A. 1982. Phytotoxins // The Annual Review of Biochemistry 51: 309–333. Snyder, L. R., And Kirkland, J. J. 1979. Introduction in modern liquid chromatography, New York, USA, 881 p. 17 SOLANAPYRONES PRODUCED BY TURKISH ISOLATES OF ASCOCHYTA RABIEI AND THEIR PHYTOTOXICITY ON CHICKPEAS Sugawara, F. And Strobel, G.A., 1987. Tryptophol, a phytotoxin produced by Drechslera nodulosum. Phytochem 26:1349-1351. Trapero-Casas, A., And Kaiser, W.J. 1992. Development of Didymella rabiei, the teleomorph of Ascochyta rabiei, on chickpea straw. Phytopathology. 82: 1261-1266. Türkkan, M., And Dolar F. S. 2009. Determination of pathogenic variability of Didymella rabiei, the agent of ascochyta blight of chickpea in Turkey. Turkish Journal of Agriculture and Forestry33(6): 585-591. Udupa, S. M., And Weigand, F. 1997. Pathotyping of Ascochyta rabiei isolates of Syria. DNA markers and breeding for resistance to ascochyta blight in chickpea. Proceedings of The Symposium on “Application of DNA Fingerprinting for Crop Improvement: Marker Assisted Selection of Chickpea for Sustainable Agriculture in The Dry Areas, ICARDA. – 11-12 April 1997, Syria. Yoder, O. C. 1980. Toxins in pathogenesis. Annual Review of Phytopathology 18: 103–129. Zerroug, M. M., Bouznad, Z., Larous, L., And Strange, R. N. 2007. Production of solanapyrone A by Algerian isolates of Ascochyta rabiei as the cause of the toxicity of culture filtrates to chickpea (Cicer arietinum) seeds and seedlings. Journal of Plant Pathology 89 (2): 227–232. 18 J. Turk. Phytopath., Vol. 39 No. 1-3, 19-29, 2010 ISSN 0378 - 8024 Reactions of Local Maize Cultivars to Fusarium verticillioides Based on Disease Severity and Production of Pectolytic Enzymes and Zearalenone Toxin* Orhan BÜYÜK** Nuray ÖZER*** * This study is a part of Master thesis, accepted by Institute of Natural and Applied Sciences of Namık Kemal University ** Plant Protection Central Research Institute, Food, Agricultural and Livestock Ministry, Ankara 06172 Turkey *** Department of Plant Protection, Faculty of Agriculture, Namık Kemal University, Tekirdağ 59030, Turkey Accepted for publication March 13, 2013 ABSTRACT Eleven local maize cultivars from the West Black Sea Region of Turkey were analyzed for reactions to Fusarium verticillioides, the causal agent of ear rot in maize. Tests were based on disease severity, associated quantitative and qualitative polygalacturonase (PG) and pectate lyase (PL) activities, and zearalenone (ZEA) concentration after kernel inoculation by pathogen. The kernels of same cultivars were also tested for the presence of ZEA before inoculation. The pathogen caused low disease severity and exhibited low PG and no PL activity in the cultivars Bartın22 and Düzce50. ZEA concentration in all cultivars except two of them were below the recommended limits before inoculation of the pathogen and increased at very low rates in the cultivars Bartın22, Düzce50 and Düzce97 after inoculation. PG and PL activities were positively correlated with disease development. This study suggests the importance of pectolytic enzyme activity produced by F. verticillioides in maize kernels at the early phases of pathogenesis and it can be possible use in monitoring resistance. Keywords: Fusarium verticillioides, cultivar reactions, pectate lyase, polygalacturonase, zearalenone toxin INTRODUCTION Maize (Zea mays L.) is one of the most important agricultural crop in hot and temperate regions around the world. Turkey is the world's 21st producer with an average production of about 4.5 million tons in the last year (FAOSTAT 2010). The crop is currently the third cereal being cultivated after wheat and barley in the country. However ear rot caused by Fusarium verticillioides (Sacc.) Nirenberg (FV) (Synonym F. moniliforme Sheldon), (Telemorph, Gibberella moniliformis) is a limiting factor in maize production. Typical symptoms of the disease are individual or groups of infected kernels scattered randomly on the entire ear. Whitish-pink fungal growth can be seen on infected kernels and/or silks. The pathogen is also known with a “starburst symptom” of white or pink streaks radiating from silk insertion of the kernel or from the base (Payne 1999). Additionally it is able to grow in kernels without causing visible symptoms, as a seedborne endophyte (Munkvold et al. 1997) Pectolytic enzymes produced by this pathogen could play a role in tissue colonization. Endopolygalacturonase of FV is expressed during maize seedling infection and may be necessary for fungal penetration even in monocotyledons (Daroda et al. 2001). Inoculation of the roots of tomato and cauliflower with FV isolated from mangrove plants showed that the pathogen produced PG and PL in hypocotyls and roots of tomato and cauliflower (Niture and Pant 2007; Niture et al. 2008). PG and PL isoforms of the pathogen were generally detected under in vitro conditions (Rao et al. 1996; Posada et al. 2001; Niture et al. 2001; Niture and Pant 2004). A few studies reported that the pathogen produced PG isoforms during infection of tomato (Niture and Pant 2004) and maize seedling (Daroda et al. 2001); but the role of PGs and PLs in determining pathogenesis in maize kernels remains unclear. 19 REACTIONS OF LOCAL MAIZE CULTIVARS TO FUSARIUM VERTICILLIOIDES BASED ON DISEASE SEVERITY AND PRODUCTION OF PECTOLYTIC ENZYMES AND ZEARALENONE TOXIN FV is known as a producer of fumonisins (FUM) and studies have focused on this toxin in the pathogen (Presello et al. 2007; Presello et al. 2008; Blandino et al. 2009; Löffler et al. 2010a; Miedaner et al. 2010; Mukanga et al. 2010). However, deoxynivalenol (DON), nivenol (NIV) and zearalenone (ZEA) were also detected in the ears and kernels of maize from which FV was commonly isolated (Cvetnić et al. 2005; Adejumo et al. 2007a; Adejumo et al. 2007b). Previously Büyük (Büyük O., 2009, unpublished data) analyzed the presence of Fusarium spp and their mycotoxins in the kernels of local cultivars from growers' fields in the West Black Sea Region of Turkey. He determined that FV was the most commonly isolated fungus (71%). Samples were analyzed for the mycotoxins FUMB1, DON and ZEA using the technique of LC/MS/MS. Thirty-eight per cent of these samples exceeded the recommended limit for FUM and sixty-one for ZEA. DON was not detected in the samples. It is well known that ZEA is dangerous for animals and humans. It causes reproductive disorders of farm animals and may cause premature thelarche in humans (Pitt 2000; Zöllner et al. 2002). To minimize the risk of human exposure to this mycotoxin, the European Union and Turkey released limits for ZEA (300 ppb) in unprocessed maize for use indirectly as human food in 2007 (EU Commission 2007). Results from the Büyük study showed that the kernels of 11 local cultivars did not contain any Fusarium species, thus providing a possibility for their natural resistance to FV. The mechanism of maize resistance to FV is complex (Presello et al. 2004). Evaluations associated with kernel resistance to this pathogen are based on pericarp thickness and wax content (Hoenisch and Davis 1994; Sampietro et al. 2009), presence of dominant resistance genes, defence related genes and enzymes (Clement et al. 2004; Presello et al. 2004; Lanubile et al. 2010; Lanubile et al. 2012), disease severity level and FUM concentration (Presello et al. 2007; Presello et al. 2008; Schjøth et al. 2008; Löffler et al. 2010 a; Löffler et al. 2011). Production of pectolytic enzymes and toxins by the pathogen during the early stages of kernel germination may represent a reliable indicator of resistance. This study was conducted to assess the resistance of local cultivars, previously found to be free of any Fusarium species (Büyük O., 2009, unpublished data), to infection by FV based on production of pectolytic enzymes and ZEA during kernel germination after artificial inoculation of the pathogen. MATERIALS AND METHODS Plant Material Eleven local maize cultivars (Bartın22, Bartın43, Bartın47, Bolu74, Bolu84, Düzce50, Düzce72, Düzce97, Zonguldak3, Zonguldak8 and Zonguldak14) collected from the West Black Sea Region of Turkey were assayed. Ears of each cultivar were dried at room temperature for one week and shelled. These cultivars were previously characterized for the absence of any Fusarium spp. placing the kernels of each cultivar on different agar media (Potato Dextrose Agar, Synthetic Nutrient Agar, Pepton PCNB Agar, Water Agar) and sterile filter paper (Blotter method) moistened with sterile distilled water in 9 cm petri dishes. Kernel samples were stored at 4oC until used in assays. Culture of the fungus Isolate FV61* was obtained from naturally infected maize growing in the West Black Sea Region of Turkey and used to produce the inoculum. This isolate was selected for its high level of aggressiveness in preliminary tests (data not shown) and it was grown in Potato Dextrose Agar (PDA, Oxoid; Unipath Ltd., Basingtone, UK). For enzyme preparation, the isolate was surface cultured in Czapek's liquid medium (pH 5.0) containing NaNO3 (2 g/l), KH2PO4 (1 g/l), MgSO4.7H2O (0.5 g/l), KCl (0.5 g/l), FeSO4.7H2O (0.01g/l), ZnSO4.7H2O (0.01g/l) and 10 g/l citrus pectin as the sole carbon source. The inoculum was one agar disc (6 mm diameter) cut from the edge of a 7-day-old-culture on PDA. Cultures were grown for 7 days at 25oC in 250-ml Erlenmeyer flasks containing 50 ml of medium in an incubator (Binder KB240; GmbH, Tutttingen, Germany). * This isolate was identified by Prof. Dr. B. Tunalı (Department of Plant Protection, Faculty of Agriculture, Ondokuz Mayıs University) 20 O. BÜYÜK, N. ÖZER Kernel inoculation Kernels from each cultivar were surface sterilized by immersing them in a 1% solution of sodium hypochlorite for 5 min, rinsing in sterile distilled water and air drying on sterile filter paper. Five kernels were placed in a petri dish containing PDA. A total of forty petri dishes were prepared from each cultivar. Agar discs (1 cm) from the edges of 7-day-old cultures on PDA were placed on each kernel (Sneh and Ichielevich-Auster 1998). The same number of kernels without inoculation was prepared as control for each cultivar. All petri dishes were incubated in the dark at 25oC for 7 days. Disease assessment Germinating kernels were rated according to the following 0 to 3 scale: 0, no damage; 1, undeveloped root and infected root-tips; 3, no germination, kernels completely colonized. The percentage of disease severity (DS) was calculated from the following equation (Unterstenhöfer 1963). DS= Σ ratings of each germinating kernel X 100 Total number of germinating kernels rated X the high score Enzyme extraction from fungus culture and inoculated maize kernels After 7 d of growth on Czapek liquid medium, FV isolate mycelial mats from three flasks were gently removed. The culture filtrates were centrifuged at 15.000xg/rpm for 15 min at 4oC. Supernatants were dialysed against several changes of distilled water at 4oC. Enzyme preparations from kernels were obtained by grinding infected tissues in an ice-cooled mortar in 0.05 M Tris-HCL buffer pH 7.8 (1 g tissue/ml buffer) containing 0.1 M KCl, 0.5% (mass/v) cysteine, and 1% (mass/v) insoluble polyvinylpolypyrrolidone (Sigma Chemical Co., St. Louis, MO, USA). The mixture was then strained through three layers of cheesecloth, centrifuged at 15.000xg/rpm for 20 min at 4oC, and dialysed several times against distilled water. The same procedures were applied to control kernels. Pectolytic enzyme assays PG activity was determined as the increase of reducing end-groups over time according to Nelson's method (Nelson 1944), slightly modified, using D-galacturonic acid (Sigma Chemical Co.) as a standard. Activity was expressed as reducing units (RU). One RU was defined as the amount of enzyme producing 1 µmol/min of reducing groups from 0.25% (mass/v) polygalacturonic acid (Sigma Chemical Co.) in sodium acetate buffer (0.1 M, pH 5.0) at 35oC. PL activity was assayed spectrophotometrically by measuring the increase in absorbance at 235 nm. An increase in absorbance of 1.73 indicated the formation of 1 µmol of unsaturated uronide (Zucker and Hankin 1970). One unit of enzyme activity catalyzed the formation of 1 µmol/min of unsaturated uronide from 0.25% (mass/v) polygalacturonic acid in Tris-HCl buffer (0.1 M, pH 8) at 35oC. The experiments were conducted twice. Isoenzyme identification Isoenzyme separation by isoelectric focusing (IEF) was realized horizontally with a Mini IEF cell apparatus (Bio Rad, Milano, Italy) using 0.4 mm thick polyacrylamide gels containing 5% (v/v) ampholyte (Sigma Chemical Co.) and covering a pH range of 3.5-10.0. The gels were run at 200 V, 450 V, 600 V and 950 V for 15, 30, 20 and 25 minutes, respectively. After IEF, the gels were overlaid with ultrathin (0.4 mm) agarose gels for PL and PG isoenzyme detection, prepared as described by Ried and Collmer (1985). For PL isoenzyme detection, a 1% (mass/v) agarose (Sigma Chemical Co.) gel contained 0.1% (mass/v) polygalacturonic acid buffered at pH 8.0 with 50 mM Tris-HCl; for PG isoenzyme detection, a 1% (mass/v) agarose gel contained 0.1% (mass/v) polygalacturonic acid in 50 mM sodium acetate buffer, pH 5.0. The runs were conducted twice. 21 REACTIONS OF LOCAL MAIZE CULTIVARS TO FUSARIUM VERTICILLIOIDES BASED ON DISEASE SEVERITY AND PRODUCTION OF PECTOLYTIC ENZYMES AND ZEARALENONE TOXIN IEF polyacrylamide gels overlaid with ultrathin agarose gels were incubated at 100% relative humidity for 120 min at 35oC. Activity bands were visualized by staining the agarose overlay for 30 min in 0.05% (mass/v) ruthenium red (Sigma Chemical Co.), followed by rinsing in distilled water. PL and PG isoenzymes appeared as white bands. The isoelectric point (pI) values of pectolytic isoenzymes were estimated from a regression equation of standard protein vs. the distance migrated. Zearalenone Analysis Samples (50 g) from each local cultivar were ground to fine powder in a mill (Retsch ZM 200 GmBH Co. Kg., Haan, Germany) at 230V, 50/60Hz, 1100W,12A with 20 mm mesh screen; 25 g were taken for toxin analysis. The toxin was extracted in 100 ml methanol:water (80:20 v/v) containing 4 g sodium chloride using a reciprocating shaker (Johann Otto, GmBH, Germany) at 230V, 50/60 Hz, 0,16A for 1 hour. The mixture was separated through Whatman filter no.4 paper. ZEA toxin standard was from Sigma-Aldrich (Germany). The analysis of ZEA was carried out using HPLC after sample clean up by immunoaffinity column following the method described by Visconti and Girolamo (2005). The filtrate (10 ml) was mixed with 40 ml distilled water and filtered through glass microfiber. The mixture (20 ml) was rapidly passed through the immunoaffinity column at a flow rate of one or two drops per sec. The column was washed with 20 ml of distilled water (two drops per sec) and dried by flushing air through the column. The Zearalenone was eluted by passing 1.5 ml HPLC grade acetonitrile through the column. The eluate was mixed with deionized water (1.5 ml) and passed through a filter (0.2 µm), then transferred to an autosampler vial. HPLC equipment of the Agilent 1100 (Agilent, USA) series was used. The stationary phase was ZORBAX EclipseXDB, C18 column (4.6X150 mmX5 µm, Agilent) and the eluent was acetonitrile:water (1:1, v/v); the flow rate was adjusted to 1.0 ml/min. For detection a Fluorescence Detector was used with wavelengths set at λ ex 232 nm and λ em 440 nm. Detection limits of the method ranged between 50 and 800 ppb. The linearity (R) of the standard curve was 0.99927. The recovery rates ranged from 83% to 104 %. The limit of quantification (LOQ) for the toxin was 300 ppb on maize. Data analysis Quantitative data on PG, PL, and DS (%) were statistically evaluated by analysis of variance (one-way ANOVA). Statistical significance of mean differences was estimated according to the Duncan multiple range test (P=0.05). The increase of ZEA after inoculation was calculated as increase % [= (ZEA concentration of kernel after inoculation (Z1) − that of kernel before inoculation)/Z1 X 100]. The Pearson coefficient of simple correlation (r) was calculated between DS and PG, PL, and ZEA production for various infected cultivars. Data statistics were performed using SPSS 15.0 for Windows (Statistical Package for Social Sciences, Inc., 2001, Chicago). RESULTS Disease severity of the cultivars Kernels of eleven local maize cultivars inoculated with FV isolate were monitored 7 days after inoculation along with uninoculated kernels for the development of visible symptoms (Figure 1). Disease severity differed significantly among the cultivars. The cultivars Bartın22 and Düzce50 showed very low disease severity. Maximum disease (91.5%) was observed in the kernels of cv. Zonguldak14 followed by Bartın47, Bolu84 and Bartın43, and they were statistically different from other cultivars. 22 O. BÜYÜK, N. ÖZER Figure 1. Disease severity (± SE) caused by Fusarium verticillioides on the kernels of different cultivars. Ba: Bartın, Bo: Bolu, Dz: Düzce, Zg: Zonguldak. Bars topped by the same letters do not differ significantly, according to the Duncan Multiple Range Test (p<0.05). Pectolytic enzymes of FV in liquid culture and during kernel colonization of different cultivars During the 7-day growth period in liquid culture, FV61 produced a higher amount of PG and PL enzyme activities than infected kernels (Table 1). When FV61 was able to colonize maize kernels of different cultivars, production of two pectolytic enzymes (PG and PL) were found depending on the cultivar. The pathogen produced PG in all cultivars whereas PL was found in only three of them. Significant differences in PG and PL production were found among the cultivars tested, being significantly low RU and absent in cultivars Düzce50, Bartın22 and Bolu74, respectively; medium RU and absent in Bartın 43, Düzce97 and Zonguldak8, respectively. However, PG production by pathogen was significantly high in Bolu84, Zonguldak3 and Zonguldak14, compared with other cultivars. Table 1. Polygalacturonase (PG) and pectate lyase (PL) activity from liquid culture and from kernels of local maize cultivars inoculated with Fusarium verticillioides Local Cultivars Bartın22 Bartın43 Bartın47 Bolu74 Bolu84 Düzce50 Düzce72 Düzce97 Zonguldak3 Zonguldak8 Zonguldak14 Liquid culture PG (RU) 0.46±0.03 ef 0.63±0.06 de 0.83±0.06 bc 0.47±0.01 e 1.37±0.08 a 0.42±0.02 f 0.73±0.03 cd 0.60±0.06 de 0.94±0.06 b 0.58±0.05 def 0.95±0.08 b 2.30±0.05 PL (U) 0.00±0 c 0.00±0 c 0.00±0 c 0.00±0 c 0.13±0.003 a 0.00±0 c 0.10±0.006 b 0.00±0 c 0.00±0 c 0.00±0 c 0.12±0.003 a 0.35±0.01 PG activity is expressed as reducing units (RU), PL activity as units (U). Means (±SE) in each column followed by the same letters do not differ significantly, according to the Duncan Multiple Range Test (p<0.05). Enzyme extracts of the isolate from culture filtrates and infected kernel tissues were separated by IEF on thin layer polyacrylamide gels and evaluated for their PG and PL isoenzyme patterns. Three PG isoenzyme forms, PG1 (pI 4.7), PG4 (pI 6.6), PG5 (pI 7.2) were observed from liquid culture (Figure 2). No PG bands were resolved from extracts of cultivars Bartın22, Bartın43, Düzce50, Düzce72, Zonguldak97 and Zonguldak8 inoculated with the pathogen. Cultivars Bartın47, Zonguldak3 and Zonguldak14 were characterized by the presence of PG4; Bartın47 by one acidic and two basic extra-bands at pI 5.5 (PG2-very faint), pI 8.1 (PG6-faint), and pI 8.5 (PG7); Bolu84 by one acidic extra-band at pI 5.9 (PG3-faint), and PG6 and PG7; and Bolu74 by PG3. 23 REACTIONS OF LOCAL MAIZE CULTIVARS TO FUSARIUM VERTICILLIOIDES BASED ON DISEASE SEVERITY AND PRODUCTION OF PECTOLYTIC ENZYMES AND ZEARALENONE TOXIN One acidic and five alkaline PL isoenzyme patterns, PL1 (pI 6.6), PL2 (pI 7.2), PL3 (pI 7.4), PL4 (pI 8.1), PL5 (pI 8.5) and PL7 (pI 9.3) were detected from the culture filtrate of the pathogen (Fig. 3). PL3 and PL4 were observed from the cultivars Bolu84 and Zonguldak14, respectively. Extra bands PL6 (faint-pI 8.7) and PL7 (very faint) were expressed in the cultivars Bolu84, Düzce72 and Zonguldak14. The pathogen did not exhibit any PL isoenzyme pattern in kernels of cultivars Bartın22, Bartın43, Bartın47, Bolu74, Düzce50, Düzce97, Zonguldak3 and Zonguldak8. Figure 2.Polygalacturonase isoenzyme patterns (white bands) from liquid culture and from kernels of different local maize cultivars inoculated with Fusarium verticillioides. Ba: Bartın, Bo: Bolu, Dz: Düzce, Zg: Zonguldak. Estimated pIs are indicated on the left, pIs of standard proteins (S.P) on the right. Figure 3. Pectate lyase isoenzyme patterns (white bands) from liquid culture and from kernels of different local maize cultivars inoculated with Fusarium verticillioides. Ba: Bartın, Bo: Bolu, Dz: Düzce, Zg: Zonguldak. Estimated pIs are indicated on the left, pIs of standard proteins (S.P) on the right. 24 O. BÜYÜK, N. ÖZER ZEA concentration Kernels of the local cultivars, which did not contain any Fusarium spp., were analyzed for ZEA before and after inoculation of the pathogen (Table 2). Among the cultivars, Bolu84 and Zonguldak3 had ZEA concentrations higher than EU and Turkey limits before and after pathogen inoculation, although the increase in concentration was low in cultivar Bolu84 after inoculation. ZEA concentrations in other cultivars did not exceed the maximum limits in either treatment. The lowest increase was detected in the local cultivar Düzce97, followed by Düzce72, Düzce50 and Bartın22. Table 2. Zearalenone (ZEA) concentration in local maize cultivars (Fusarium spp-free) before and after inoculation with Fusarium verticillioides, and increase in toxin concentration Local Cultivar Bartın22 Bartın43 Bartın47 Bolu74 Bolu84 Düzce50 Düzce72 Düzce97 Zonguldak3 Zonguldak8 Zonguldak14 ZEA concentration (ppb) After Before inoculation inoculation 286.40 293.10 76.40 108.20 129.10 163.70 124.30 136.70 343.40 356.40 106.27 107.63 250.70 253.00 276.30 278.40 307.60 376.30 272.81 286.40 220.10 236.70 Increase in toxin concentration (%) 2.28 23.39 21.13 9.07 3.64 1.26 0.90 0.75 18.25 4.74 7.01 Correlations between disease severity and pectolytic enzymes and ZEA production A linear correlation existed between disease severity of the cultivars tested and PG (r=0.68, p<0.05) and PL (r=0.61, p<0.05) activities detected from diseased tissues upon inoculation with the pathogen. There was no correlation between disease severity and ZEA production. DISCUSSION Some ear and kernel characteristics of specific cultivars provide chemical and mechanical barriers to ear rot infection caused by FV (Hoenisch and Davis 1994; Munkvold, 2003; Sampietro et al. 2009; Lanubile et al. 2010; Lanubile et al. 2012). Maize genotypes or cultivars from different countries are currently characterized for their resistance to infection by FV and also to FUM accumulation in kernels using silk channel inoculation of spore suspension (Presello et al. 2007; Presello et al. 2008; Miedaner et al. 2010; Löffler et al. 2010 a; Löffler et al. 2010b; Löffler et al. 2011) and side needle inoculation (Lanubile et al. 2010) under field conditions. Ears and kernels of maize infected with FV can contain other mycotoxins such as DON, NIV and ZEA (Cvetnić et al. 2005; Adejumo et al. 2007b). In one of the project (Büyük, O., 2009, unpublished data), it was determined that the rate of ZEAcontaminated kernels exceeding the recommended limit was higher than FUM-contaminated kernels. However information on the effect of ZEA on resistance to FV in maize kernels is lacking. In addition, Fusarium spp. perforates the seed coat and invades the endosperm producing pectolytic enzymes as well as mycotoxins (Kikot et al. 2009). No studies have addressed the role of pectolytic enzymes in resistance to the same disease. However, these enzymes are thought to play a role in the infection by FV of tomato, cauliflower and maize seedling (Daroda et al. 2001; Niture and Pant 2004; Niture and Pant 2007; Niture et al. 2008). In this study we evaluated disease severity as well as production of pectolytic enzymes and ZEA by FV to determine resistance to ear rot of maize cultivars, and we examined the relationships among them. Eleven local pathogen-free cultivars from the Black Sea Region of Turkey were used in the study. 25 REACTIONS OF LOCAL MAIZE CULTIVARS TO FUSARIUM VERTICILLIOIDES BASED ON DISEASE SEVERITY AND PRODUCTION OF PECTOLYTIC ENZYMES AND ZEARALENONE TOXIN Virulence and production of PG and PL pectolytic enzymes by the pathogen varied greatly depending on cultivar. Our results demonstrated different degrees of susceptibility among the cultivars; “Düzce50” was the most resistant based on the disease severity, the production of PG and PL by pathogen; “Bolu84” was a susceptible cultivar in which the pathogen exhibited the highest PG and PL activity; another susceptible cultivar, “Zonguldak14”, had the highest disease severity and the pathogen produced high PG and PL enzyme activity. The high resolving capacity and sensitivity of the staining technique for pectolytic activity after IEF permitted the detection of a number of isoenzymes of PG and PL. Three PG isoenzyme forms (PG1, PG4 and PG5) were expressed in the extracts from liquid culture; among them one PG form (PG4, pI 6.6) appeared during pathogenesis in susceptible maize cultivars. This suggests that this form may be important for colonizing the pathogen into the kernel tissues. Daroda et al (2001) determined that a commercial preparation of FV produced four endo PG isoforms (38.0, 41.5, 45.0 and 48.5 kDa) in vitro and in infected maize seedlings. In our experiments extra PG acidic and alkaline isoforms, which were not expressed in liquid culture, were detected in the extracts from infected kernels of some cultivars. Among those, an alkaline PG isoenzyme focusing at pI 8.1 during infection of kernels of sensitive cultivars Bartın47 and Bolu84 was also previously reported in liquid culture of the pathogen and during infection of tomato tissue (Niture et al. 2001; Niture and Pant 2004). This study showed that during growth on pectin as a sole carbon source, FV produced PL activity and six PL isoforms, although Rao et al. (1996) detected the presence of a PL isoenzyme form (pI 9.1) in the extracts from liquid culture. Low levels of PL activity and four isoenzyme forms as faint bands were identified during infection of local cultivars Bolu84, Zonguldak14 and Düzce72. Studies reporting PL isoforms produced by FV during maize kernel or seedling infection are not available in the literature. It has been shown in various plant-fungal pathogen interactions that the ability to produce symptoms parallels the level of PG isolated from infected tissues (Baayen et al., 1997; Le Cam et al. 1997; García-Maceira et al. 2001; Roncero et al. 2003). Positive correlations between disease development and PG and PL activity by the pathogen in the infected maize kernels are suggestive of a possible causal relationship. The IEF analysis did not show isoenzyme forms of PG and PL from local cultivars Bartın22, Bartın43, Düzce50, Düzce97, which also had low disease severity. FV can produce FUM in kernels without visible disease symptoms (Munkvold et al. 1997). Our results also demonstrated the presence of ZEA in symptomless kernels of different local cultivars. Interestingly, no Fusarium spp. could be found in these cultivars. It is well known that sporulation and mycotoxin production in Fusarium are both regulated by G protein signaling pathways which commonly regulate fungal development, stress response and expression of virulence. However fungal development is also influenced by external factors such as lipids and, in particular, oxylipin signals in maize kernels which have the potential to elicit profound changes in sporulation in the fungus (Brodhagen and Keller 2006). Although amounts of oxylipin in maize kernels were not determined in the current study, the results based on presence of ZEA in Fusarium spp-free kernels indicates that sporulation of Fusarium spp, including FV, seems to be affected by oxylipin content of the kernels. This study clearly showed that laboratory inspection of maize kernels alone for the presence of FV is not a reliable predictor for ZEA. ZEA concentrations tested in nine cultivars before and after inoculation were under the recommended maximum limits. The least increase in concentration after inoculation was recorded in cultivar Düzce97, followed by Düzce72, Düzce50 and Bartın22. These cultivars showed low disease severity, but ZEA concentration was not significantly correlated with disease severity. In previous studies, no correlation or a negative association between disease severity and FUM concentration for FV was observed (Presello et al. 2007; Presello et al. 2008; Covarelli et al. 2012). Conversely, in another study a positive correlation between disease severity and FUM concentration was recorded (Löffler et al. 2011). Therefore we hypothesize that ZEA production depends on the given Fusarium isolate, the substrate and the environment. In conclusion, for this set of cultivars and experimental conditions, local cultivars Bartın22 and Düzce50 were determined as resistant to FV. Cultivar Düzce 97 showed low disease severity and had also the lowest increase in ZEA concentration after inoculation with FV. The enzyme activity tests described in this study can be used as 26 O. BÜYÜK, N. ÖZER additional tools to evaluate resistance mechanisms to FV as well as contributing to a better understanding of the infection ability of this pathogen. ACKNOWLEDGMENTS This research was supported by the General Directorate of Agricultural Researches and Policies of Food, Agricultural and Livestock Ministry, Turkey (Project No: TAGEM-BS-09/07-03/05-/02). We are grateful to Dr. Martha Rowe (University of Nebraska-Lincoln) for improving the language and for useful remarks. ÖZET HASTALIK ŞİDDETİ, PEKTOLİTİK ENZİM VE ZEARALENONE ÜRETİMİ AÇISINDAN YEREL MISIR ÇEŞİTLERİNİN Fusarium verticillioides ´E KARŞI REAKSİYONLARI Türkiye´nin Batı Karadeniz Bölgesinden toplanan 11 yerel mısır çeşidinin mısırda koçan çürüklüğü etmeni Fusarium verticillioides´e karşı reaksiyonları belirlenmiştir. Testlerde, etmenin mısır tanelerine inokulasyonundan sonra oluşan hastalık şiddeti, kalitatif ve kantitatif poligalakturonaz (PG) ve pektat liyaz (PL) enzim aktiviteleri, ve zearalenone (ZEA) üretimi dikkate alınmıştır. Aynı çeşitlerin tanelerinde inokulasyondan önceki ZEA miktarı da tespit edilmiştir. Patojen Bartın22, Düzce50 çeşitlerinde düşük hastalık şiddetine neden olmuş, az miktarda PG sergilemiş, PL üretmemiştir. İki çeşit hariç, tüm çeşitlerde inokulasyondan önceki ZEA konsantrasyonu sınırların altında olmuş, inokulasyondan sonra ise Bartın22, Düzce50 ve Düzce97 çeşitlerinde çok düşük oranlarda artış göstermiştir. PG ve PL aktiviteleri ve hastalık oluşumu arasında pozitif bir ilişki olduğu belirlenmiştir. Bu çalışma sonuçlarına göre mısır tanelerinde hastalık oluşumunun başlangıcında F. verticillioides tarafından üretilen pektolitik enzimlerin önemli olduğu ve dayanıklılığı kontrol etmek için kullanılabileceği ileri sürülebilir. Anahtar kelimeler: Fusarium verticillioides, çeşit reaksiyonu, pektat liyaz, poligalak-turonaz, zearalenone toksini LITERATURE CITED Adejumo, T.O., Hettwer, U., Karlovsky, P. 2007a. Occurrence of Fusarium species and trichothecenes in Nigerian maize. Int. J. Food Microbiol. 116: 350-357. Adejumo, T.O., Hettwer, U., Karlovsky, P. 2007b. Survey of maize from south-western Nigeria for zearalenone, αand β-zealarenols, fumonisin B1 and enniatins produced by Fusarium species. Food Addit. Contam. 24: 9931000. Baayen, R.P., Schoffelmeer, E.A.M., Toet, S., Elgersma, D.M. 1997. Fungal polygalacturonase activity reflects susceptibility of carnation cultivars to fusarium wilt. Eur. J. Plant Pathol. 103: 15-23. Blandino, M., Reyneri, A., Vanara, F.. 2009. Effect of sowing time on toxigenic fungal infection and mycotoxin contamination of maize kernels. J. Phytopathol. 157: 7-14. Brodhagen, M., Keller, N.P. 2006. Signalling pathways connecting mycotoxin production and sporulation. Mol. Plant Pathol. 7: 285-301. Clement, M.J., Maragos, C.A., Pataky, J.K., White, D.G. 2004 Sources of resistance to fumonisin accumulation in grain and fusarium ear and kernel rot of corn. Phytopathology 94: 251-260. Covarelli, L., Simonetta, S., Beccari, G., Raggi, L., Lattanzio, V.M.T., Albertini, E. 2012. Characterization of Fusarium verticillioides strains isolated from maize in Italy: Fumonisin production, pathogenicity and genetic variability. Food Microbiol. 31: 17-24. Cvetnić, Z., Pepeljnjak, S., Šegvić, M. 2005 Toxigenic potential of Fusarium species isolated from non-harvested maize. Arch. IndHyg. Toxiol. 56: 275-280. 27 REACTIONS OF LOCAL MAIZE CULTIVARS TO FUSARIUM VERTICILLIOIDES BASED ON DISEASE SEVERITY AND PRODUCTION OF PECTOLYTIC ENZYMES AND ZEARALENONE TOXIN Daroda, L., Hahn, K., Pashkoulov, D., Benvenuto, E. 2001. Molecular characterization and in planta detection of Fusarium moniliforme endopolygalacturonase isoforms. Physiol. Mol. Plant Pathol. 59: 317-325. EU Commission, 2007. Commission Regulation (EC), No: 1126/2007 setting maximum levels for certain contaminants in foodstuffs as regards fusarium toxins in maize and maize products. Official Journals of the European Union, L255/14-L255/19. FAOSTAT, 2010. FAO Statistical Databases. (Web page: http://faostat.fao.org) (Data accessed: December 2010) Garcia-Maceira, F.I., Di Pietro, A.D., Huertas-González, M.D., Ruiz-Roldán, M.C., Roncero, M.I. 2001. Molecular characterization of an endopolygalacturonase from Fusarium oxysporum expressed during early stages of infection. Appl. Environ. Microbiol. 67: 2191-2196. Hoenisch, R.W., Davis, R.M. 1994. Relationship between kernel pericarp thickness and susceptibility to Fusarium ear rot in field corn. Plant Dis. 78: 517-519. Kikot, G.E., Hours, R.A., Alronoda, T.M. 2009. Contribution of cell wall degrading enzymes to pathogenesis of Fusarium graminearum: a review. J. Basic Microbiol. 49: 231-241. Lanubile, A., Pasini, L., Marocco, A. 2010. Differential gene expression in kernels and silks of maize lines with contrasting levels of ear rot resistance after Fusarium verticillioides infection. J. Plant Physiol. 167: 13981406. Lanubile, A., Bernardi, J., Marocco, A., Logrieco, A., Paciolla, C. 2012. Differential activation of defence genes and enzymes in maize genotypes with contrasting levels of resistance to Fusarium verticillioides. Environ. Exp. Bot. 78: 39-46. Le Cam, B., Lebreton, L., Massiot, P., Rouxel, F. 1997. Production of cell-wall polysaccharide degrading enzymes in carrot root tissues infected by Mycocentrospora acerina. Plant Pathol. 46: 276-281. Löffler, M., Miedaner, T., Kessel, B., Ouzunova, M. 2010a. Mycotoxin accumulation and corresponding ear rot rating in three maturity groups of European maize inoculated by two Fusarium species. Euphytica 174: 153164. Löffler, M., Kessel, B., Ouzunova, M., Miedaner, T. 2010b. Population parameters for resistance to Fusarium graminearum and Fusarium verticillioides ear rot among large sets of early, mid-late and late maturing European maize (Zea mays L.) inbred lines. Theor. Appl. Genet. 120: 1053-1062. Löffler, M., Kessel, B., Ouzunova, M., Miedaner, T. 2011. Covariation between line and testcross performance for reduced mycotoxin concentrations in European maize after silk channel inoculation of two Fusarium species. Theor. Appl. Genet. 122: 925-934. Miedaner, T., Bolduan, C., Melchinger, A.E. 2010. Aggressiveness and mycotoxin production of eight isolates each of Fusarium graminearum and Fusarium verticillioides for ear rot on susceptible and resistant early maize inbred lines. Eur. J. Plant Pathol. 127: 113-123. Mukanga, M., Derera, J., Tongoona, P., Laing, M.D. 2010 A survey of pre-harvest ear rot dieases of maize and associated mycotoxins in South and central Zambia. Int. J. Food Microbiol. 141: 213-221. Munkvold, G.P. 2003. Cultural and genetic approaches to managing mycotoxins in maize. Annu. Rev. Phytopathol. 41: 99-106. Munkvold, G.P., Hellmich, R.L., Showers, W.B. 1997. Reduced Fusarium ear rot and symptomless infection in kernels of maize genetically engineered for European corn borer resistance. Phytopathology 87: 1071-1077. Nelson, N. 1944. A photometric adaptation of the Smogyi method for determination of glucose. J. Biol. Chem. 153: 375-380. Niture, S.K., Pant, A. 2004. Purification and biochemical characterization of polygalacturonase II produced in semisolid medium by a strain of Fusarium moniliforme. Microbiol. Res. 159: 305-314. 28 O. BÜYÜK, N. ÖZER Niture, S.K., Pant, A. 2007. Production of cell wall-degrading enzymes by a pH tolerant estuarine fungal isolate Fusarium moniliforme NCIM1276 in different culture conditions. World J. Microbiol. Biotechnol. 23: 11691177. Niture, S.K., Pant, A., Kumar, A.R. 2001. Active site characterization of the single endo-polygalacturonase produced by Fusarium moniliforme NCIM 1276. Eur. J. Biochem. 268: 832-840. Niture, S.K., Kumar, A.R., Parab, P.B., Pant, A. 2008. Inactivation of polygalacturonase and pectate lyase produced by pH tolerant fungus Fusarium moniliforme NCIM 1276 in a liquid medium and in the host tissue. Microbiol. Res. 163: 51-62. Payne, G.A. 1999. Ear and kernel rots. Pages 44-49 in: Compendium of Corn Diseases. D.G. White, ed. American Phytopathological Society, St. Paul, MN, USA. Pitt, J.I. 2000. Toxigenic fungi and mycotoxins. Br. Med. Bull. 56: 184-192. Posada, M.L., Patino, B., Mirete, S., Munoz, M.C., Vazquez, C., Gonzalez-Jaen, M.T. 2001. Comparative analysis of polygalacturonases in isolates of seven species of Fusarium from Pinus pinea. Mycol. Res. 105: 100-104. Presello, D.A., Reid, L.M., Mather, D.E. 2004. Resistance of Argentine maize germplasm to Gibberella and Fusarium ear rots. Maydica 49: 83-91. Presello, D.A., Iglesias, J., Botta, G., Eyhérabide, G.H. 2007. Severity of Fusarium ear rot and concentration of fumonisin in grain of Argentinian maize hybrids. Crop Protec. 26: 852−855. Presello, D.A., Botta, G., Iglesias, J., Eyhérabide, G.H. 2008. Effect of disease severity on yield and grain fumonisin concentration of maize hybrids inoculated with Fusarium verticillioides. Crop Protec. 27: 572-576. Rao, M.N., Kembhavi, A.A., Pant, A. 1996. Role of lysine, tryptophan and calcium in the beta-elimination activity of low-molecular-mass pectate lyase from Fusarium moniliforme. Biochem. J. 319: 159-164. Ried, J.L., Collmer, A. 1985. Activity stain for rapid characterization of pectic enzymes in isoelectric focusing and sodium dodecyl sulphate-polyacrylamide gels. Appl. Environ. Microbiol. 50: 615-622. Roncero, M.I.G., Hera, C., Ruiz-Rubio, M., Garcia Maceira, F.I., Madrid, M.P., Caracuel, Z., Calero, F., DelgadoJarana, J., Roldan-Rodriguez, R., Martinez-Rocha, AI. 2003. Fusarium as a model for studying virulence in soilborne plant pathogens. Physiol. Mol. Plant Pathol. 62: 87-98. Sampietro, D.A., Vattuone, M.A., Presello, D.A, Fauguel, C.M., Catalan, C.A.N. 2009. The pericarp and its surface wax layer in maize kernels as resistance factors to fumonisin accumulation by Fusarium verticillioides. Crop Protec. 28: 196-200. Schjøth, J.E., Tronsmo, A.M., Sundheim, L. 2008. Resistance to Fusarium verticillioides in 20 Zambian maize hybrids. J. Phytopathol. 156: 470-479. Sneh. B., Ichielevich-Auster, M. 1998. Induced resistance of cucumber seedlings caused by some non-pathogenic Rhizoctonia (np-R) isolates. Phytoparasitica 26: 27-38 Unterstenhöfer, G. 1963. The basic principles of crop protection field trials. Pflanzenschutz-Nachrichten 3: 155−156. Visconti, A., Girolamo, A. 2005. Fitness for purpose – ochratoxin A analytical developments. Food Addit. Contam. Suppl. 1: 37-44. Zöllner, P., Jodlbauer, J., Kleinova, M., Kahlbacher, H., Kuhn, T., Hochsteiner, W., Lindner, W. 2002. Concentration levels of Zearalenone and its metabolites in urine, muscle tissue, and liver samples of pigs fed with mycotoxin-contaminated oats. J. African Food Chem. 50: 2494-2501. Zucker, M., Hankin, L. 1970. Regulation of pectate lyase synthesis in Pseudomonas fluorescens and Erwinia caratovora. J. Bacteriol. 104: 13-18. 29 REACTIONS OF LOCAL MAIZE CULTIVARS TO FUSARIUM VERTICILLIOIDES BASED ON DISEASE SEVERITY AND PRODUCTION OF PECTOLYTIC ENZYMES AND ZEARALENONE TOXIN 30 J. Turk. Phytopath., Vol. 39 No. 1-3, 31-37, 2010 ISSN 0378 - 8024 Toxin Production and DNA Sequence Analysis of Turkish Isolates of Ascochyta rabiei, the Causual Agent of Ascochyta Blight in Chickpea F. Sara DOLAR University of Ankara, Faculty of Agriculture, Department of Plant Protection, 06110, Ankara, (Turkey) Accepted for publication March 10, 2013 ABSTRACT In this study, twenty isolates of Ascochyta rabiei were isolated from disease-enfecteol chickpea plants which were collected from chickpea growing areas in Turkey. In order to determine solanapyrone production of these isolates, the fungus was grown on Czapek Dox liquid culture medium (CDLCM) for 12 day at two different temperatures. Quantitation of solanapyrones was determined with HPLC analyses. The results demonstrated that all isolates produced solanapyrone A in CDLCM at 200C but not at 300C. Confirmation of the identity of the pathogen was sought by sequence analysis of rDNA. These experiments showed that the sequences of the internal transcribed spacers (ITS) and 5.8 S gene of the seven isolates, which were identical to each other, were also identical to that of a Pakistan isolate of A.rabiei. rDNA sequences of the PCR products of isolates of A.rabiei which were produced different amount of toxin were same. Keywords: Solanapyrone, Ascochyta rabiei, Chickpea, DNA Sequence INTRODUCTION Chickpea (Cicer arietinum L.) is an important legume crop in several parts of the world, such as West Asia, North Africa, Central and South America (Nene 1982; Singh and Reddy 1990). It is the most produced legume crop of Turkey (Anonymous 2008). The most important disease of chickpea is Ascochyta blight caused by Ascochyta rabiei (Pass.) Labr. Serious crop losses occur when environmental conditions, especially cool, wet weather, favour disease development and spread (Singh and Reddy 1990). This fungus, which is known to be seed-borne, causes characteristic dark necrotic lesions on the stems, leaves and pods of the host, and severe infection can kill the plants (Maden et al. 1975; Nene 1982). The taxonomy of Ascochyta species have been based on morphology and host plant association. Classification systems based upon data from morphological studies have been mostly successful. However, in some cases, morphology has been unsuccessful in characterizing fungi. Recently, significant advances in fungal taxonomy and identification have come about through DNA analysis. A wide range of molecular techniques are available for the identification of fungi, including Restriction Fragment Length Polymorphism (RFLP) and Random Amplified Polymorphic DNA (RAPD). Fungi of the genus Ascochyta have not been extensively studied by molecular tools. Some publications describe DNA fingerprinting of A. rabiei, by means of RFLPs (Weising et al. 1991), RAPD (Fischer et al. 1995) and the RAPD-like PCR technique (DAF)-DNA amplification fingerprinting (Kaemmer et al. 1992). RFLP has been used to solve systematic problems in the genus Phytophthora (Förster et al., 1990), to characterize Pythium species (Wang and White, 1997) and to determine genetic polymorphism among isolates of A. rabiei (Morjane et al., 1994). A large group of A. rabiei isolates were analysed by RAPD but analysis of the combined data failed to reveal any correlation between amplification patterns and pathotype clasification (Fisher et 31 TOXIN PRODUCTION AND DNA SEQUENCE ANALYSIS OF TURKISH ISOLATES OF ASCOCHYTA RABIEI, THE CAUSUAL AGENT OFASCOCHYTA BLIGHT IN CHICKPEA al. 1995). Fatehi and Bridge (1998) detected multiple rRNA-ITS regions within nine cultures of Ascochyta and Khan et al.(1999) distinguished A.rabiei from Phoma medicaginis var pinodella both of which were found in lesions on chickpea in Australia. Sequence data of an appropriate part of the fungal genome provides unequivocal identification of fungal species. Analysis of DNA sequences, particularly those of the ribosomal repeat unit, has proved to be a definitive and rapid method for the identification and taxonomic studies of fungi as well as for the studies of evolution and speciation (White et al. 1990). This technique has been used to identify fungi and to delineate species (Sherriff et al. 1995: Kusaba and Tsuga 1995). An organism may damage plants by secreting one or more toxins. Early symptoms of Ascochyta blight include epinasty, loss of turgor and cellular disintegration. It has been suggested that such symptoms could result from toxin production by the pathogen (Höhl et al. 1991, Hamid and Strange 2000). In liquid culture, isolate of A.rabiei have been reported to synthesizses a total of four toxic compounds; solanapyrone A, B, C and cytochalasin D (Alam et al. 1989; Höhl et al. 1991; Latif et al. 1993) which are released in the culture medium. Solanapyrones A, B and C were first found in culture filtrates of Alternaria solani, the causal agent of early blight of tomato and potato (Matern et al. 1978). The chemical structure of these toxins were elucidated by NMR-spectroscopy and mass- spectrometry (Ichihara et al.,1983). Phoma exiqua var. heteromorpha, which was formerly known as Ascochyta heteromorpha, produced cytochalasins A, B, U and V when grown on a semi-synthetic medium (Capasso et al. 1991) The objective of this research was to determine production of toxin by Turkish isolates of A.rabiei and demonstrate DNA sequence of A.rabiei isolates which produced different amount of toxin or not. MATERIALS and METHODS Ascochyta rabiei Isolates Isolates of Ascochyta rabiei, designated T 1-22, were isolated from diseased leaves, stems and pods of chickpea collected from chickpea growing areas in different regions (Central Anatolia, South Eastern Anatolia and Aegean) of Turkey. These cultures were cultivated on the CSMDA medium (Chickpea Seed Meal Dextrose Agar: chickpea meal 40 g, dextrose 20 g, agar 20 g, distilled water 1 l) at 20±20C with a 12 h period of near UV light for 10 days. From these cultures, single spore isolates were obtained. Inoculum was further multiplied on chickpea seeds according to Alam et al. (1987). After incubation at 200C for 7-10 days the inoculated seeds were agitated with sterile distilled water and the spores suspended in 10% glycerol (107 spore ml-1 )..The suspension was distributed to 1.8 ml Nunc tubes in 1 ml aliquots and were stored in liquid nitrogen. Toxin Production and HPLC Analysis The fungus was grown on Czapek Dox liquid culture medium, consisting of Czapek Dox nutrients supplemented with zinc sulphate (50 mg/l), manganese chloride (20mg/l), calcium chloride (100mg/l), cobalt chloride (20mg/l), cupric chloride (20mg/l) per litre (CDLCM; Chen and Strange, 1991). After distribution to 250 ml Erlenmeyer flasks (30 ml per flask) and autoclaving, each flask was inoculated with 30µl spore suspension (107 spores ml-1) of A.rabiei and incubated without shaking at 200C and 300C in continuous light for 12 days. The fungus was removed by filtration through 6 layer of muslin and filtered using Whatman No.1 filter paper. Mycelial mats and the relatively few spores were discharged and dried at 800C for 48 h to give a measure of fungal growth. Samples of the filtrates (30 ml) were passed through an Isolute 1g C18 cartridge (International Sorbent Technology Ltd., Mid Glamorgan, UK) and after washing with water (5.0 ml), toxin was eluted with acetonitrile (100%:2.0ml). Samples of the acetonitrile eluate (20µl) were injected onto a Philips HPLC consisting of a PU4100 quaternary pump, PU4021 diode array detector and computer equipped with PU6003 diode array software for data handling. The stationary phase was a Jones Chromatography C18 column ODS (5µm particle size: 4.6 x 150 mm: Jones Chromatography Ltd., Mid Glamorgan, UK). The column was developed with a mobile phase consisting of 32 F. S. DOLAR tetrahydrofuran 20.6%, methanol 23.1% and bidistilled water 56.3% at a flow rate 1.0 ml/min. The solanapyrones were recognized by their retention times and their characteristic UV spectra, which were compared with authentic samples. Chromatograms were abstracted from the chromascans at λ=327nm and solanapyrone A quantified by reference to an external standard of the compound. Growth of Ascochyta rabiei and DNA Extraction Isolates (T-4, 5, 9, 10, 14, 15 from Turkey and P-8 from Pakistan) were grown in a medium consisting of Czapek-Dox Nutrients (45.5 g: Oxoid, Unipath Ltd., UK), bacto peptone (1g), yeast extract (1g), casein hydrolysate (1g), dissolved in 1 L water and supplemented with 200 ml of clarified V-8 juice (Campbell Grocery Products Ltd., UK) prepared by filtering the juice through four layers of muslin and centrifuging at 20009g for 5 min. The medium was distributed to 250 ml Erlenmeyer flasks (100 ml per flask) and autoclaved at 1210C for 20 minutes. After cooling to room temperature, 0.01g of Streptomycin sulphate was added to each flask. Spore suspension (100 μl: 1x107 spore/ml) of isolates, which were stored in liquid nitrogen, were used to inoculate the medium. After incubation for 3 days at 250C on an orbital shaker the mycelia were harvested. DNA was extracted using a commercial kit (Nucleon Phytopure Plant DNA Extraction Kit, Scotlab, UK) according to the manufacturer`s instructions. Precipitated DNA was resuspended in 180 μl of TE buffer (10mM Tris-HCl, 1mM EDTA, pH 8.0) and 20μl RNase (1mg/ml) was added. After incubation at 370C for 1 hour on a shaker, DNA concentration and purity was ascertained by monitoring UV absorption at 260 and 280 nm and by electrophoresis in 1% agarose gel containing ethidium bromide (0.2 μg ml-1 gel). DNA Amplification The two internal transcribed spacers (ITS1 and ITS2) and the 5.8S rDNA were amplified with the primer pairs ITS1F (5′-CTTGGTCATTTAGAGGAAGTAA-3′) (Gardes and Bruns, 1993) and ITS4 (5′TCCTCCGCTTATTGATATGC-3′) (White et al. 1990). Each DNA sample (50ng) and the two primers (10pmol of each) were added to a “Ready to Go” PCR bead (Amersham Pharmacia Biotech Inc., Sweden) which contained 1.5 units of Taq DNA polymerase, 10 mM Tris-HCl (pH 9.0), 50mM KCl, 1.5mM MgCl2 and 200 μM of each dNTP when brought to a final volume of 25 μl. The PCR conditions were 40 cycles of 1 min at 940C, 45 s at 500C, 2 min at 720C, followed by a final extension step of 5 min at 720C (Fatehi and Bridge 1998) PCR products were electrophoresed in 1.7 % agarose gel. DNA Sequencing and Analysis DNA sequencing of PCR products were performed using the ABI PRISM Big Dye Terminator Cycle Sequencing Ready Reaction Kit (Protocol number 4303152) with AmpliTaq DNA polymerase (Perkin Elmer Corporation) using an ABI PRISM 377 DNA Sequencer according to the manufacturer`s instructions. Primers ITS1F and ITS4 (Gardes and Bruns, 1993; White et al. 1990) were used to sequence the PCR products. The sequences of the PCR products were aligned by the clustal method using the programme MAGI (Multiple Alignment General Interface) at the HGMP-RC (Human Genome Mapping Project Resource Centre; www.hgmp.mrc.ac.uk) according to the service providers instructions. A reference A.rabiei sequence was obtained from CABI and compared with sequences from the Turkish isolates using the cluster method of MAGI. RESULTS AND DISCUSSION Production of Solanapyrone A by Ascochyta rabiei Isolates The variation in solanapyrone A concentrations of the culture filtrates from 21 isolates of A.rabiei is shown in Fig.1. Toxin production varied from 0.89 to 11.0 μg/g dry weight of mycelium after 12 days on Czapek-Dox 33 TOXIN PRODUCTION AND DNA SEQUENCE ANALYSIS OF TURKISH ISOLATES OF ASCOCHYTA RABIEI, THE CAUSUAL AGENT OFASCOCHYTA BLIGHT IN CHICKPEA Liquid Cation Medium (CDLCM) at 200C. Isolate T-21 produced the highest concentrations of the solanapyrone A with values of 11.0 μg/g dry weight of mycelium. T-17, T-15 and T-12 produced 8.79, 8.04 and 7.73 solanapyrone A μg/g dry weight of mycelium on the same medium, respectively. Three isolates (T-1, T-22 and T-11) produced small amounts of sol A. All of 20 Turkish isolates produced solanapyrone A on CDLCM but not sol B and sol C. No solanapyrones were detected in culture filtrates of any isolates incubated at 300C. Figure 1. Production of solanapyrone A (μg/g dry weight mycelium) of isolates Ascochyta rabiei grown on Czapek-Dox Liquid Cation Medium The solanapyrones were first described as products of Alternaria solani, the causal agent of early blight of potato and tomato (Ichihara et al. 1983). Alam et al. (1989) isolated two toxins from culture filtrates of Ascochyta rabiei and identified them as solanapyrones A and C. Further work in which the fungus was grown on chickpea seed extract with glucose or Richard’s medium (Höhl et al 1991) or a defined medium (Chen and Strange 1991) allowed additionally the production of solanapyrone B. Latif et al. (1993) found one of nine strains of the A.rabiei produced a cytochasin which was identified as cytochalasin D. The results reported in this paper demonstrate the capacity of twenty one pathogenic isolates of the fungus to synthesize phytotoxic compounds in vitro. All of the isolates produced solanapyrone A in CDLCM at 200C but not at 300C. It is known that many toxins are responsible for pathogenicity of fungus (Wheeler and Luke 1955, Nadel and Spiegel-Roy 1988, Vidhyasekaran et al. 1990). Whereas it is not difficult to show the relevance of host-selective toxins to pathogenicity since isolates that lose their ability to produce toxin are non-pathogenic, it is more difficult to demonstrate the role of non-selective toxins in disease (Strange 1998). Solanapyrone compounds by the fungus A.rabiei are not selectively toxic but the symptoms caused by the solanopyrone A, epinasty, chlorosis and necrosis, are consistent with the disease (Strange 1997). Furthermore cuttings allowed to take up solanopyrone A lodged, a symptom typical of the disease (Hamid and Strange 2000). Solanapyrone produced by A.rabiei may therefore be related to the virulence of the pathogen. Sequence Data DNA was successfully extracted from six Turkish isolates of A.rabiei which produced different amounts solA and a Pakistan isolate of fungus using the commercial kit .An amplicon of about 600 bp was obtained with the primers ITS1F and ITS4 from all isolates. Sequencing of the amplicons which contained the ITS1 region (139bp), the 5,8 S gene (158bp) and ITS2 region (143bp) showed that they were identical (Fig2). Confirmation of the identity of the pathogen was sought by sequence analysis of rDNA. These experiments showed that the sequences of the internal transcribed spacers and 5.8 S gene of the six Turkish isolates, which were identical to each other and, were also identical to that of a Pakistan isolate of A.rabiei. Thus, the causal agent of blight of chickpea in Turkey was additionally confirmed to be A.rabiei at the molecular level. Two interpretations of 34 F. S. DOLAR the perfect match of the DNA sequences of the Turkish and the Pakistan isolates are that either these regions are particularly conserved within in A.rabiei or that the Pakistan and Turkish isolates are of common origin. A.rabiei isolates obtained from Paul Bridge (CABI) contained one more base pair in ITS1 region (140bp) than Turkish and Pakistan isolates of A.rabiei. ITS 1CCTAGAGTTTGTGGGCTTTGCCCGCTACCTCTTACCCATGTCTTTTGAGTACTTACGTTTCCTCGGCGGGTCCGCCCG CCGATTGGACAAAATCAAACCCTTTGCAGTTGCAATCAGCGTCTGAAAAACATAATAGTTA 5.8 S CAACTTTCAACAACG GATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAA TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTT ITS 2 GTACCTTCAAGCTTTGCTTGGTGTTGGGTGTTTGTCTCGCCTCTGCGTGTAGACTCGCCTTAAAACAATTGGCAGCCGGCG TATTGATTTCGGAGCGCAGTACATCTCGCGCTTTGCACTCATAACGACGACGTCCAAAAGTA Figure 2. Sequences of the internal transcribed spacer (ITS) 1, the 5.8 S and the ITS2 regions (440bp in total) of the Turkish isolates of Ascochyta rabiei. Ribosomal DNA (rDNA) sequences have been aligned and compared in a number of living organism. Studies of rDNA sequences have been used to infer phylogenetic history across a very broad spectrum, from studies among the basal lineages of life to relationships among closely related species and populations (Hillis and Dixon 1991). In this study, all isolates were confirmed as A.rabiei by rDNA sequencing and they all produced solanapyrone A although the amounts were variable. These data provide additional evidence for the importance of solanopyrone A to the pathogen since if its production were gratuitous some isolates would be expected not to produce the compound, particularly as the fungus has a sexual stage, Didymella rabiei. ACKNOWLEDGEMENTS I am grateful to Dr. Richards Strange for his great help and supervision. I also wish to acknowledge Miss Laura Winskill for sequencing the PCR products. and Dr. Paul Bridge (CABI)) for providing A.rabiei isolate. This project was funded by British Council. ÖZET NOHUTTA ASCOCHYTA YANIKLIKLIK ETMENİ ASCOCHYTA RABIEI’NIN TÜRK İZOLATLARININ TOKSİN ÜRETİMİ VE DNA SEKANS ANALİZLERİ Bu çalışmada 20 adet Ascochyta rabiei izolatı Türkiye’nin nohut üretimi yapılan alanlarından toplanan hastalıklı nohut bitkilerinden izole edilmiştir. İzolatlar solanapyrone üretimlerinin belirlenmesi için 12 gün süreyle iki farklı sıcaklıkta Czapek Dox sıvı kültür ortamında (CDLCM) geliştirilmişlerdir. Solanapyronların kantitatif ölçümleri HPLC analizi ile yapılmıştır. Tüm izolatların sıvı ortamda (CDLCM) 200C de solanapyrone A ürettikleri buna karşın 300C de üretmedikleri tespit edilmiştir. Patojenin teşhisinin doğrulanması rDNA sekans analizi ile yapılmıştır. Bu çalışmada yedi izolatın ITS ve 5.8 S gen bölgelerinin sekanslarının hem birbirleri ile hem de A.rabiei’nin Pakistan izolatı ile aynı olduğu görülmüştür. Farklı miktarlarda toksin üreten A.rabiei izolatlarının PCR ürünlerinin rDNA sekansları aynı bulunmuştur. Anahtar kelimeler: Solanapyrone, Ascochyta rabiei, Nohut, DNA Sekans. 35 TOXIN PRODUCTION AND DNA SEQUENCE ANALYSIS OF TURKISH ISOLATES OF ASCOCHYTA RABIEI, THE CAUSUAL AGENT OFASCOCHYTA BLIGHT IN CHICKPEA LITERATURE CITED Alam, S.S., Strange, R.N. and Qureshi, S.H., 1987. Isolation of Ascochyta rabiei and a copious inoculum production. The Mycologist, 21: 20. convenient method for Alam, S.S., Bilton, J.N., Slawin, A.M.Z., Williams, D.J., Sheppard, R.N. and Strange, R.N. 1989. Chickpea blight: production of the phytotoxins solanapyrones A and C by Ascochyta rabiei. Phytochemistry, 28:2627-2630. Anonymous, 2008. F.A.O. http://www.fao.org. (Date accessed: May 2008) Capasso, R., Evidente, A. and Vurro, M.,1991. Cytochalasins from Phoma exiqua var heteromorpha. Phytochemistry, 30:3945-3950. Chen, Y.M. and Strange, R.N., 1991. Synthesis of the solanapyrone phytotoxins by Ascochyta rabiei in response to metal cations and development of a defined medium for toxin production. Plant Pathology, 40:401-407. Chen, Y.M., Peh, E.K. and Strange, R.N., 1991. Application of solvent optimisation to the separation of the phytotoxins, solanopyrone A,B and C from culture filtrates of Ascochyta rabiei. Bioseparation,2:107-113. Fatehi, J. and Bridge, P., 1998. Detection of multiple rRNA-ITS regions in isolates of Ascochyta. Mycological Research, 102:762-766. Fischer, C., Porta-Puglia, A. and Barz, W.,1995. RAPD analysis of pathogenic variability in Ascochyta rabiei. J. Phytopathology, 143:601-607. Förster, H., Oudemans, P. and Coffey, M.D., 1990. Mitochondrial and nuclear DNA diversity within six species of Phytophthora. Experimental Mycology, 14:18-31. Hamid K and Strange RN. 2000. Phytotoxicity of solanopyrone A and B produced by the chickpea pathogen Ascochyta rabiei (Pass.)Labr. and apparent metabolism of solanopyrone A by chickpea tissues. Physiol. and Mol. Plant Pathol. 56:235-244. Hillis, D.M. and Dixon, M.T., 1991. Ribosomal DNA: molecular evolution and phylogenetic inference. The Quarterly Review of Biology, 66:411-453. Höhl, B., Weidemann, C., Höhl, U. and Barz, W. 1991. Isolation of solanapyrone A, B and C from culture filtrates and spore germination fluids of Ascochyta rabiei and aspects of phytotoxin action. J. Phytopathology, 132:193-206. Ichihara, A., Tazaki, H. and Sakamura, S., 1983. Solanapyrones A, B and C, phytotoxic metabolites from the fungus Alternaria solani. Tetrahedron Letters, 24: 5373-5376. Kaemmer, D., Ramser, J., Schon, M., Weigand, F., Saxena, M.C., Driesel, A.J., Kahl, G. and Weising, K., 1992. DNA fingerprinting of fungal genomes: a case study with Ascochyta rabiei. Advance Molecular Genetics, 5: 255-270. Khan, M.S.A, Ramsey, M,D,,Corbiere,R., Infantino, A., Porta-Puglia, A., Bouznad, Z. and Scott, E.S.1999. Ascochyta blight of chickpea in Australia: identification, pathogenicity and mating type .Plant Pathology. 48:230-234. Kusaba, M. and Tsuge, T. 1995. Phylogeny of Alternaria fungi known to produce host-specific toxins on the basis of variation in internal transcribed spacer of ribosomal DNA. Current Genetics. 28: 491-498. Latif, Z., Strange, R.N., Bilton, J. and Riazuddin, S., 1993. Production of the phytotoxins, solanapyrones A and C and cytochalasin D among nine isolates of Ascochyta rabiei. Plant Pathology, 42:172-180. Maden, S., Singh, D., Mathur, S.B. and Neergaard, P., 1975. Detection and location of seed-borne inoculum of Ascochyta rabiei and its transmission in chickpea (Cicer arietinum L.). Seed Science & Technology, 3:667-681. Matern, U., Strobel, G.A. and Shepard, J., 1978. Reaction to phytotoxins in a potato population derived from mesaphyll protoplasts. Proceedings of the National Academy of Science, USA. 75:4935-4939. Morjane, H., Geistlinger, J., Harrabi, M., Weising, K. and Kahl, G., 1994. Oligonucleotide fingerprinting detects genetics diversity among Ascochyta rabiei isolates from a single chickpea fields in Tunisia. Current Genetics, 26:191-197. 36 F. S. DOLAR Nadel, B. and Spiegel-Roy, P.,1988. Selection of citrus-limon culture variants to mal secco toxin. Plant Science, 53:177-182. Nene, Y.L., 1982. A review of ascochyta blight of chickpea. Tropical Pest Management, 28:61-70. Sherriff, C., Whelan, M.J., Arnold, G.M. and Bailey, J.A., 1995. rDNA sequence analysis confirms the distinction between Colletotrichum graminicola and C. sublineolum. Mycological Research, 99:475-478. Singh, K.B. and Reddy, M.V., 1990. Pattern of resistance and susceptibility to races of Ascochyta rabiei among germ plasm accesions and breeding lines of chickpea. Plant Disease, 74:127-129. Strange, R.N., 1997. Phytotoxin associated with Ascochyta species. In Toxins in Plant Disease Development and Evolving Biotechnology (Upadhyay, R.K. and Mukerji, K.G., eds). New Delhi: Oxford&IBH Publishing Co. Pvt. Ltd.,pp 167-181. Strange, R.N., 1998. Plants under attack II. Science Progress, 81:35-68. Vidhyasekaran, P.,Ling,D.H., Borromeo, E.S., Zapata, F.J. and Mew, T.W. 1990. Selection of brown spot-resistant rice plants from Helminthosporium oryzae toxin resistant calluses. Annals of Applied Biology, 117, 515-523. Wang, P.H. and White, J.G. 1997. Molecular characterization of Pythium species based on RFLP analysis of the internal transcribed spacer region of ribosomal DNA. Physiological and Molecular Plant Pathology, 51:129143. Weising, K., Kaemmer,D., Epplen, J., Weigend, F., Saxena, M. and Kahl G. 1991. DNA fingerprinting of Ascochyta rabiei with synthetic oligodeoxynucleotides. Current Genetics, 19:483-489. Wheeler, H. and Luke, H.H. (1995). Mass screening for disease-resistant mutants in oats. Science, 122:1229. White, T.J., Bruns, T., Lee, S. and Taylor, J. 1990. Ampflication and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols, a Guide to Methods and Applications (Innis, M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J., eds.) San Diego, Academic Press., 315-322. 37 TOXIN PRODUCTION AND DNA SEQUENCE ANALYSIS OF TURKISH ISOLATES OF ASCOCHYTA RABIEI, THE CAUSUAL AGENT OFASCOCHYTA BLIGHT IN CHICKPEA 38 J. Turk. Phytopath., Vol. 39 No. 1-3, 39-44, 2010 ISSN 0378 - 8024 Determination of Variety Reaction to Potato Wart Disease (Synchytrium endobioticum) in Potato Planting Areas of Nevsehir Province, Turkey Hale GÜNAÇTI* Ali ERKILIÇ** * Biological Control Research Station,01321, Adana ** Department of Plant Protection, Faculty of Agriculture, University of Cukurova, 01330 Adana, TURKEY. Accepted for publication February 09, 2013 ABSTRACT Potato wart disease is caused by the soil borne fungus Synchytrium endobioticum (Schilberszky) Percival belong to Chytridiomycetes class as an obligate fungus. In order to determine the varietal reactions against the pathogen, an experiment was conducted in Derinkuyu district in Nevşehir, in 2008. Thirty varieties including industrial and table ones, were used in the trial. The lowest disease intensity ratio (11.1%) was recorded on Jelly variety. In addition, 15 varieties showing much tolerant reaction than Jelly variety were placed in the same group, statistically. Binella was found as the most susceptible variety with the disease intensity in rate of 26.2 %. In general, the most resistant variety was Jelly (11.1 %) and the most susceptible variety was Binella (26.2 %). Nearly half of the varieties showed disease intensity ratios between 11.1–15.4 %, and the rest showed 16.0-26.2 % disease reaction. Key Words: Potato, Synchytrium endobioticum, susceptibility, resistance INTRODUCTION Potato (Solanum tuberosum L.) as a member of Solanaceae family, originated Peru and the Andean region of Bolivia. Potato was introduced to our country at the end of 19th Century, first of all in Eastern Black Sea region, and then the west of Thrace (Simsek, 2002). According to 2009 data, potatoes had 18.326.242 hectares of plantation area, 329.556.911 tons of production and 1798,3 kg of yield around the world. According to 2009 data, the planting area was 142.684 hectares, production 4.397.711 tons and the yield 3082,1 kg in Turkey (FAO, 2009). Turkey ranked number seven after China, Russia, India, Poland, USA and Germany in terms of the amount of planting area and production (Anonymus, 2002). The potato wart disease spread at the end of the nineteenth century from its original range in the Andes in South America to parts of North America and Europe and then other potato growing countries like in Asia, Africa, and Oceania continents (EPPO/CABI, 1997). Potato Wart Disease is caused by the soil borne fungus Synchytrium endobioticum (Schilberszky) Percival belong to Chytridiomycetes class as an obligate fungus (Langerfeld, 1984). Resting spores of the fungus in soil are extremely long lived, in the range of 10-40 years or more (Langerfeld, 1984; Laidlaw, 1985; Hampson, 1996; EPPO/CABI, 1997; Strachewicz ve Langerfeld, 1998). The pathogen usually preferring cool climates is known to exist in 43 countries today (Baayen et al. 2006). Losses due to the disease have been changing between 50 and 100 percent worldwide (Hampson, 1993; Melnik, 1998). The first determination of disease was taken place in 1992 in Ordu (Aybastı), Niğde (Ağcaşar) and Nevşehir (Kaymaklı, Derinkuyu) in Turkey. 39 DETERMINATION OF VARIETY REACTION TO POTATO WART DISEASE (SYNCHYTRIUM ENDOBIOTICUM) IN POTATO PLANTING AREAS OF NEVSEHIR PROVINCE, TURKEY A typical symptom of the disease occurring on tubers is cauliflower-like warts or tumors of different sizes. Initially the size of warts changes from pea size to hand punch size with white to green color. Above-ground warts are green but later become black and subterranean warts are white to brown, becoming black on decayed area (Hampson, 1981). The disease can cause symptoms to the underground components of potato plants including crown, stolons and tubers except roots (Hampson ve Haard, 1980). Phytosanitary regulations, national and international, have been applied throughout the world for nearly a century to prevent spread of the fungus. The time that infected fields are identified, strict phytosanitary control and prohibition of cultivation of susceptible cultivars have been the main components of official control. Because the serious nature of the disease and the fact that spores can remain viable in the soil for many years it has to be controlled in the European Union by a Wart Disease Directive (EU, 1969). According to the legislation, potatoes cultivation does not allowed on the area which an outbreak has occurred. Therefore, only the resistant cultivars may be grown in a safety zone around the infected sites. The purpose of this study was to find out the efficacy of some applications to provide a base for Potato Wart Disease control, since there is any control measures exist, apart from quarantine legislations in Turkey. For this purpose, susceptibility of potato varieties was tested to the pathogen in the soil. MATERIALS AND METHODS In this study, 30 potato varieties were used which are commercially grown in Turkey, named as; Agata, Agria, Almera, Ambition, Anuckha, Armada, Binella, Cosmos, Elfe, Elodi, Esprit, Faluca, Floris, Hermes, Jelly, Consul, Latona, Madeleine, Marabel, Maranca, Marfona, Markies, Matador, Milva, Presto, Provento, Safran, Sante, Van Gogh, Zafira. In order to determine the variety reactions against the pathogen, a study was conducted in Derinkuyu district in Nevşehir, in 2008. A total of 30 varieties including industrial and table ones were used in the trials. The experiment was established according to completely randomized design with three replications. The study was conducted on infested soil in the pots (25 cm) in the open air. The pots were filled with S. endobioticum infected soil from Derinkuyu and two potatoes from each potato varieties were planted. And then, 150g of inoculum from the pathogen compost was prepared like the method of Spieckermann and Kothoff (1924) added in the pots and covered with infected soil. At the end of the vegetation period of 120 days, the plants were pulled out and all the underground plant parts, root, underground housing, stolons and tubers were evaluated (Figure 1). After harvest, the tubers’ wart development was evaluated for the stem base, stolons and tubers by rating on the scale of 1-9 (EPPO, 2004) where 1=Not affected, 2=Single proliferation (<5 mm), 3= 2 or 3 proliferations (<5 mm) or a single larger one (5-10 mm), 4=Several small warts (5-10 mm), 5=Several medium-sized warts (>10mm), 6=Several large warts, at last one of these being > 10 mm, and beginning deformation of the tuber, 7=Large warts with a diameter of > 10 mm and disruption of tuber formation, 8=Very large warts, but individual tubers still recognizable, 9=Very large warts, no normal tubers present. Preparation of Synchytrium endobioticum Inoculum and Compost Production S. endobioticum inoculum and compost production were prepared using the fresh warts on potato tubers according to the method of Spieckermann and Kothoff, (1924). Compost inoculums were obtained from the Nevşehir province. The warts were cut approx. 1cm. in size and added to sand by one portion of wart in three portions of sand (1W:3S). The mixture was incubated at 18-25°C in dark for six months and the experiments were conducted with two replicates. The production of compost was completed in three steps:1) one-third of the wart and sand mixture in the clean trays were wetted with tap water and stirred every day during a period of two months. 2) wetting and stirring processes were carried out in weekly intervals for two months 3) the compost left to dry without any wetting and stirring process and kept at +4°C for further use. 40 H. GÜNAÇTI, A. ERKILIÇ Figure 1. Wart on potato stolons, stem base and tuber Disease severity scale of values was calculated and variance analysis was applied to these values. Later, by LSD multiple comparison tests with the varieties of S. endobioticum been in their sensitivity showed differences between (Karman, 1971). RESULTS AND DISCUSSION In this work, 30 potato varieties which grown commercially in Turkey were tested for the variety reactions against the pathogen. Sensitivity tests were carried out in the field on all the varieties. In the pot tests, all plants were removed from the soil at the end of the ripening period, and then evaluated according to the scale of 1-9 in terms of formation of the potato wart. The cultivars were classified into resistance categories as given in Table 1. The lowest disease development was recorded from Jelly variety as 11.1 %. In addition, 15 varieties showing much tolerant reaction than the Jelly were placed in the same group, statistically. Binella was found as the most susceptible variety with the disease development in a rate of 26.2 %. In general, the most resistant and most susceptible varieties were Jelly (11.1 %) and Binella (26.2 %), respectively. However, the average disease incidence was resulted in between the range of 11.1–15.4 % in the half of the varieties and 16.0-26.2 % in the rest (Figure 2). 41 DETERMINATION OF VARIETY REACTION TO POTATO WART DISEASE (SYNCHYTRIUM ENDOBIOTICUM) IN POTATO PLANTING AREAS OF NEVSEHIR PROVINCE, TURKEY Table 1. Sensivity of Potato varieties to Synchytrium endobioticum Variete Jelly Matador Madeleine Almera Van Gogh Safran Ambition Anuckha Elfe Faluka Disease severity(%) 11,1 a* 11,4 ab 11,7 ab 12,0 ab 12,6 ab 13,1 ab 13,2 ab 13,3 ab 14,0 ab 14,1 ab Variete Floris Marabel Sante Maranca Zafira Hermes Agata Milva Markies Latona Disease severity(%) 14,2 ab 14,2 ab 14,3 ab 15,4 ab 15,4 ab 16,0 ab 17,3 ab 17,3 ab 17,4 b 17,4 b Variete Cosmos Marfona Agria Esprit Armada Presto Provento Consult Elodi Binella Disease severity(%) 18,7 b 18,3 b 19,8 bc 20,0 bcd 20,2 bcd 20,7 bcd 22,2 bcd 23,5 bcd 25,1 cd 26,2 d * Different letters of means are statistically different by LSD(0.05) test Figure 2. Levels of sensivity potato varieties to Synchytrium endobioticum Agria commonly grown in the region is being referred as susceptible to some sources. In this study it also showed that the severity of disease rate was 19.8% in this variety. The varieties of Van Gogh, Latona and Provento referred as resistant in some literature, however in our study it showed a disease severity of 12.6 %, 17.4 % and 22.2% respectively. The variety Provento is similar to the most susceptible variety Binella. Van Gogh has given similar results like Jelly which is the most resistant. The study done for determining the resistance and susceptibility reactions of potato varieties against potato wart disease showed that the severity of disease was between 11.1% (in Jelly, the most tolerant) and 26.2% (in Binella, the most susceptible). According to the studies in the region and observations and manufacturers' statements, the varietiy of Van Gogh is resistant to the disease. Van Gogh and 16 potato varieties which were statistically in the same group, they may likely to be tolerant against S. endobioticum in the region. However, a comprehensive study may clarify this issue with determining distribution and density of all the races of pathogen in the region. Because of the intense pressure of inoculum, both the land intensive sporangium and wart compost added to soil in pot trials, the infection was ranged between 11.1-26.2% in some potato varieties. It may not sufficient to say 42 H. GÜNAÇTI, A. ERKILIÇ these cultivars susceptible or resistant under those extreme conditions. There were some studies done in different regions in Turkey, but they were not on isolates of pathogen and their densities in the location. Only one study was carried out on reactions of potato cultivars with 6 isolates of the pathogen collected from Nevsehir and Ordu. They found that the cultivar reactions and isolates of pathogen gave different reactions in 2005 and 2007 years trials. The cultivar Miriam was resistant against Nevşehir 1 isolate in 2005 and susceptible in 2007 (Cakir et al., 2009). The observations at the harvest time for 3 years and with growers' statements in potato fields in Nigde and Nevsehir provinces showed that the Van Gogh variety is disease resistant one. In this case, the type of Van Gogh and statistically in the same group, which include the 16 potato cultivars in some regions of there may be likely to be tolerant against to S. endobioticum. However, the result may be much clear on this issue with a study on the distribution and density of all the isolates of pathogen can reveal by a comprehensive study. ÖZET NEVŞEHIR İLI PATATES EKILIŞ ALANLARINDA PATATES SİĞİL HASTALIĞI (SYNCHYTRIUM ENDOBIOTICUM)’NA KARŞI ÇEŞİT REAKSİYONLARININ BELİRLENMESİ Patatesin en önemli yumru hastalığı olan Patates Siğil Hastalığı’na Synchytrium endobioticum (Schilb) Percival neden olur. Etmen, Chytridiomycetes sınıfına ait, toprak kökenli ve obligat bir fungustur. Patates çeşitlerinin patojene karşı reaksiyonlarının belirlenmesi amacıyla 2008 yılında Nevşehir ili Derinkuyu ilçesinde bir deneme yürütülmüştür. Denemede 30 adet sanayilik ve sofralık patates çeşidi kullanılmıştır. En düşük hastalık şiddeti %11.1 oranı ile Jelly çeşidinde görülmüştür. Jelly çeşidinin ardından daha yüksek hastalık şiddeti gösteren 15 patates çeşidi de istatiksel olarak aynı gurupta yer almıştır. Binella patates çeşidi %26.2’lik hastalık şiddeti ile en duyarlı çeşit olarak bulunmuştur. Genel olarak değerlendirildiğinde denemedeki çeşitlerin en dayanıklısı Jelly (%11.1) ve en duyarlısı Binella (%26.2) olup, tüm çeşitlerin yaklaşık yarısı %11.1-15.4 arasında, diğer yarısı da %16.0-26.2arasında hastalık şiddeti göstermiştir. Anahtar Kelimeler: Patates, Synchytrium endobioticum, duyarlılık, dayanıklılık LITERATURE CITED Anonymus, (2002). http:www.fao⁄statistics. Baayen, R.P., Cochius, G., Hendriks, H., Meffert, J.P., Bakker, J. and Bekker, M., 2006. History of potato wart disease in europe a propasol for harmonisation in defining pathotypes. European Journal of Plant Pathology, 116:21–31 Çakir, E., Van Leeuwenn, G.C.M., Flath, K., Meffert, J.P., Lanssen and Maden, S. 2009. Identification of pathotypes of Synchytrium endobioticum found in infested fields in Turkey. Eppo Bulltein. 39,175-178. Eppo/Cabi. 1997. Quarantine pest for Europe, 2nd end. CABI International, Wallingford (GB). EU (1969). Council directive 69/464 of 8 December 1969 on control of potato wart disease. Official Journal of the European Communities L323, 561–562. Eppo Bulletin (Europen And Mediterrnean Plant Protection Organization). 2004. Dignostic Protocols for Regulted Pests: Synchytrium endobioticum. Eppo Bulltein Vol. 34. (2): 213–218. FAO, 2004. FAO Resmi internet sitesi verileri: http:www.fao⁄org.90. Hampson M.C. 1981. Potato sprouts and potato wart disease. Can. Agric. 26(3):30–31. Hampson M.C. 1993. History, biology and control of potato wart disease in Canada. Can. J. Plant Pathol. 15: 223–244. Hampson M.C. 1991. Agriculture and agri-food Canada atlantic cool climate crop research centre. Minister of supply and services Canada 1991. Cat No. A22-131/1991E. ISBN0-662-19166-8. 43 DETERMINATION OF VARIETY REACTION TO POTATO WART DISEASE (SYNCHYTRIUM ENDOBIOTICUM) IN POTATO PLANTING AREAS OF NEVSEHIR PROVINCE, TURKEY Hampson, M.C. 1996. A qulitative assessment of wind dispersal of resting spores of Synchytrium endobioticum the causal agent of wart disease of potato. Plant Disease, 80(7):779–782. Hampson M.C. and Haard, N.F. 1980. Pathogenesis of Synchytrium endobioticum: 1. infection responses in potato and tomato. Can. J. Plant Pathol. 2:143–147. Karman, M. 1971. Mesleki kitaplar serisi. Bitki koruma araştırmalarında genel bilgiler. denemelerin kuruluşu ve değerlendirme esasları. Bölge Zirai Araştırma Enst. İzmir-Bornova, 279 s. Laidlaw, W.M.R. 1985. A method for the detection of the resting sporangia of the potato wart disease(Synchytrium endobioticum) in the soil of old outbreak sites. Potato Res. 28:223–232. Langerfeld, E. 1984. Synchytrium endobioticum (Schilb.) Perc. zusammenfassende darstellung des erregers des kartoffelkrebses anhand von literaturberichten. mitteilungen aus der biologischen bundesanstalt für land-und forstwirtschaft. Berlin-Dahlem, 219:1–142 (in German). Melnik, P.A. 1998. Wart disease of potato, Synchytrium endobioticum (Schilb.) Perc..Eppo Technical Documents No. 1032. Eppo, Paris (Fr). Spieckermann, A. and Kothoff, P., 1924. Testing potatoes for wart resistance. Deutsche Landwirtschaftliche Presse. 51:114-115. Stachewicz, H. and Langerfeld, E., 1998. Synchytrium endobioticum (Schilb.) Perc. zur geschichte des kartoffelkrebses in deutschland. Mitteilungen Aus der Biologischen Bundesanstalt für Land-und Forstwirtschaft, Berlin-Dahlem 335:38–62. Stachewicz, H. and De Boer, S. 2002. Pathotype determination of potato wart from Prince Edwart Island, Canada. Nachrichtenblatt Fur Den Pflanzenschutz İn Der Ddr 54:269. Şimşek, Y. 2002. Patates tarımı. Ankara. 44 J. Turk. Phytopath., Vol. 39 No. 1-3, 45-66, 2010 ISSN 0378 - 8024 The Effects of Various Inactivation Treatments on Seed Germination Characteristics in Vegetable Seeds Infected with the Viruses Ismail Can PAYLAN, Semih ERKAN, Nedim ÇETINKAYA, Müge ERGUN, Ayşe CANDAR Ege University, Faculty of Agriculture, Department of Plant Protection, 35100 Bornova, Izmir, Turkey Accepted by April, 24 2013 ABSTRACT The effects of different virus inactivation methods on seed germination properties were investigated in the present study. Certain inactivation treatments applied to essential vegetable seed such as tomato, pepper, melon, squash, bean and lettuce which are important for seed production in Turkey. For the study, 8 different seed samples infected by Tomato mosaic virus (ToMV), Tobacco mosaic virus (TMV), Cucumber mosaic virus (CMV), Soybean mosaic virus (SMV) and Lettuce mosaic virus (LMV) were exposed to virus-inactivation treatments such as chemicals, dry heat, ozone, heat water and UV. As a result of treatments in question, the germination tests were applied to seed samples and the obtained data were assessed statistically. Germination powers (%) and average germination periods (day) of seeds in our work were considered for the criteria of assessments. According to test results, other seed treatments except from HCl and ozone, reduced the germination power of vegetable seeds generally. On the other hand, germination power in HCl and ozone treatments found at the similar levels with control values. Theheatwatertreatments (65 °C) reduced the germination power of seedsfrom 94% to 34%. Consequently, HCl and ozone treatments did not have any negative effects on germination values where these treatments were also successful in elimination of viral agents. Keywords: Vegetable, seed, virus inactivation treatments, seed germination. GİRİŞ Bitkisel üretimde tohumun rolü ve tohumluğun ticari bir nitelik kazanması kalite unsurunu ön plana çıkarmış ve bunun sonucunda da ulusal ve uluslararası bazda yeni yapılanmalara gidilmiştir. Bu değişimin ilk sonucu üretilen tohumluk miktarındaki artış ve bunun dikkati çeken diğer yönü ise sağlanan parasal değerde yükseliş olmasıdır. Bazı tahminlere göre dünya ölçeğinde günümüzde yılda 127-128 milyon ton tohumluk kullanılmaktadır. Bu üretimin parasal değeri yaklaşık 50 milyar $’dır. Bunun da yaklaşık 30 milyar $’lık bölümünü ticari tohumluk oluşturmaktadır. Ticari tohumluk üretimi içinde ilk sırayı ABD yaklaşık 5,7 milyar $ ile almakta onu 4,9 milyar $ toplam değerle diğer AB ülkeleri izlemektedir. Ülkemiz ise tahmini 170 milyon $ olan bir değerle oldukça gerilerde yer almaktadır. Türkiye 20-25 milyon $’lık tohum ihracatı ve 40-45 milyon $’lık tohum ithalatı değerlerine sahiptir (Açıkgöz vd.,1997). Kültür bitkilerinin yetiştirilmesinde tohumun niteliği diğer girdilerin potansiyellerini gerçekleştirebilmeleri üzerinde etkili olmaktadır. Tohumlarda kalite ve verim gibi özelliklerin yanında sağlık durumu da önem taşıyan bir konudur. Tohumlar bünyelerinde bulundurdukları hastalık etmenlerinden zarar görebildikleri gibi, bu patojenlerin yayılmalarında ve taşınmalarında aracılık görevi de yapabilmektedirler. Kültür bitkilerinin üretiminde nicel ve nitel biçimde ürün kayıplarına neden olan faktörler arasında viral kaynaklı etmenlerin ayrı bir önemi vardır. Bu etmenlere karşı diğer patojen gruplarının önlenmesi için sıkça başvurulan kimyasal savaş yönteminin uygulanamaması ve diğer kontrol yöntemlerinin de üretici tarafından yeterli düzeyde bilinmeyişi virüslerden kaynaklanan kayıpların 45 THE EFFECTS OF VARIOUS INACTIVATION TREATMENTS ON SEED GERMINATION CHARACTERISTICS IN VEGETABLE SEEDS INFECTED WITH THE VIRUSES artmasına neden olmaktadır. Viral kökenli etmenlerin önemli taşınma ve bulaşma yollarından biride tohumdur. Bitki virüslerinin belirlenen taksonomik gruplarının 28’nin 21’inde tohumla taşınmagerçekleşmektedir. Tüm bitki virüslerinin % 18’i tohumla taşınabilmektedir (Antignus, 1999). Özellikle dar konukçu dizisine sahip virüsler için tohumla taşınma yaşamı devam ettirme ve mevsimler arası geçişte bir araç olarak düşünülmektedir. Tohumla taşınma, viral hastalıkların böcek vektörler ile yayılabilmesi için ilk enfeksiyon kaynağını oluşturmaları açısından da önemlidir. Tohumla taşınan viral etmenler ticari yolla uzun mesafelere ulaşabildiği gibi, tohumun doğal özelliği nedeni ile kısa mesafelere de taşınabilmektedir (Erkan, 1998). Tohumla taşınan bazı virüslerin neden oldukları ürün kayıplarına ait örnekler Çizelge 1’de görülmektedir. Çizelge 1. Tohumla taşınan virüslerin neden oldukları ürün kayıpları (%) Virüs Adı Bean common mosaic potyvirus Broad bean stain comovirus Cucumber mosaic cucumovirus Lettuce mosaic potyvirus Pea seed-borne mosaic potyvirus Soybean mosaic potyvirus Tomato mosaic tobamovirus Tobacco mosaic tobamovirus Zucchini yellow mosaic potyvirus Ürün Fasulye Mercimek Acı bakla Marul Bezelye Soya Fasülyesi Domates Domates Kabakgil % Ürün Kayıp Oranı 35-98a 14-61b 25-42c ≤30a 11-36d 48-99e 5-50f ≤94 f 0-99a Kaynaklar: a Shukla et al. (1994), Richardson, 1990; b Makkouk and Kumari (1990); c Bwye et al. (1994); d Khetarpal and Maury (1987); e Tu (1989); f Walkey (1991); Sebze tohumlarının kalite ve kantitesini bu denli etkileyen tohum kaynaklı virüslerin mücadelesi de oldukça önem taşıyan konu halini almıştır. Bu nedenle de, sebze tohumlarındaki viral etmenlerin inaktifleştirilmesi konusunda önceki yıllarda dünyada ve ülkemizde bazı kimyasal maddeler, sıcak su ve sıcak hava uygulaması, ozon uygulaması ve depolama gibi çeşitli uygulamalar gerçekleştirilmiştir (John and Sova, 1955; Taylor et al., 1961; Gooding and Suggs, 1976; Erkan, 1983; Yorgancı vd., 1993; Değirmenci vd., 2009). Bahsedilen çalışmaların bazılarında önemli başarılar elde edilmiş, bazıları ise başarısız olmuştur. İnaktifleştirme uygulamalarında başarılı olunsa dahi en önemli konu tohumun çimlenme gücünün korunmasıdır. Zira, genelde virüsün inaktif duruma gelmesine neden olan uygulamalar aynı zamanda tohumun canlılığını da azaltmaktadır (Erkan, 1998). Bu çalışmada, sebze tohumlarında belirlenen viral etmenlerin elemine edilmesi amacıyla tohum örneklerine çeşitli kimyasal maddeler ve bazı inaktifleştirme yöntemleri uygulanmıştır. Ayrıca, bahsedilen uygulamaların tohumun çimlenmesine etkileri araştırılmıştır. Sonuçta; ülkemiz sebze üretiminde sağlıklı tohum kullanmak ve sağlıklı bitki yetiştirmek amacına hizmet etmek için gerçekleştirilecek sonraki çalışmalara basamak oluşturacak önemli bulgular elde edilmiştir. MATERYAL VE METOD Virüs İnaktifleştirme Çalışmaları ve Çimlendirme Testlerinde Kullanılan Tohum Örnekleri Gerçekleştirilen DAS-ELISA ve RT-PCR testlerinde enfeksiyon düzeyi diğerlerine oranla daha yüksek olarak saptanan örneklerden tesadüf ilkesi dikkate alınarak, her uygulama için tohum örnekleri seçilmiş ve virüs ile enfekteli tohum örnekler iinaktifleştirme uygulamalarının materyalini oluşturmuştur.Virüs inaktifleştirme uygulamalarında kullanılan tohum örnekleri ayrıca, yapılan değişik uygulamaların tohumların çimlenme güçlerine olan etkilerini araştırmak için yürütülen çimlenme testlerinin de materyalini oluşturmuştur. Tanılanan Viral Etmenlerin İnaktifleştirilmeleri Tohumlardaki virüsleri inaktifleştirme işlemleri yapılacak olan virüslü tohum örnekleri, inaktifleştirme uygulamaları belirlenmiş ve virüslerle enfekteli olan tohum örneklerinde bu uygulamalar gerçekleştirilmiştir. Daha 46 I. C. PAYLAN, S. ERKAN, N. ÇETINKAYA, M. ERGUN, A. CANDAR önceden DAS-ELISA ve RT-PCR testleri ile virüs(ler)le enfekteli oldukları belirlenen tohum örnekleri, inaktifleştirme uygulamalarından önce kontrol amaçlı olarak DAS-ELISA yöntemi ile tekrar testlenmiştir. Virüs(ler) ile enfekteli tohum örneklerine yapılacak olan inaktifleştirme uygulamaları için değişik virüsler ile enfekteli olan 8 farklı tohum örneği seçilmiştir. Bunlar arasında; • ToMVve TMV ile enfekteli domates tohum örnekleri, • TMV ve CMV ile enfekteli biber tohum örnekleri, • CMV ile enfekteli kavun tohum örnekleri, • CMV ile enfekteli kabak tohum örnekleri, • SMV ile enfekteli fasulye tohum örnekleri ve • LMV ile enfekteli marul tohum örnekleri bulunmaktadır. Viral etmenlerin inaktifleştirilmesi uygulamaları 3 tekerrürlü olarak gerçekleştirilmiştir. İlk olarak, yüksek enfeksiyon düzeyine sahip oldukları belirlenmiş olan tohum örneklerinden tesadüf ilkesi dikkate alınarak, her uygulama için 600 tohum seçilmiştir. Bu tohumlar tülbent bezi içerisine konularak ağızları lastikle kapatılmıştır. Daha sonra, hazırlanmış olan bu tohumlar 1000 ml’lik beherler içerisine belirlenen sürelerde daldırılmıştır. HCl uygulamasından sonra, tohumlar bir kap içerisinde su ile 30 dakika yıkanmıştır. Ozon uygulamalarında özel delikli kaplara konulan tohumlar belirtilen sürelerde ozon tanklarına daldırılmıştır. Kuru sıcaklık ve UV uygulamaları tohumlara direkt olarak gerçekleştirilmiştir. Sıcak su uygulaması ise ozon uygulamalarında olduğu gibi özel delikli kaplar içinde sıcak su banyosuna daldırılarak gerçekleştirilmiştir. Sıcak hava uygulamaları da etüv içerisinde kontrollü olarak belirli sıcaklık, süre ve nemde gerçekleştirilmiştir. Tohumlarda belirlenen viral etmenleri inaktifleştirmek amacı ile yapılmış olan uygulamalar Çizelge 2’de görülmektedir. Çizelge 2. Bazı Sebze Tohumu Örneklerinde Bulunan Viral Etmenlerin İnaktifleştirilmeleri İçin Yapılmış Olan Uygulamalar Uygulama Asetik asit (CH3-COOH) Hidrojen peroksit (H2O2) Hidroklorik asit (HCl) Kuru sıcaklık Ozon (O3) Ozon (O3) Ozon (O3) Sıcak su Sodyum Hipoklorit (NaOCl) Triton X 100 UV Uygulama Oranı / Sıcaklık Derecesi % 0.8 %4 %2 80 oC (%30-40 nem) 5g/m3 10g/m3 10g/m3 65 oC % 0.4 % 10 305 nm Uygulama Süresi 20 dakika 20 dakika 30 dakika – 30 dakika su ile yıkama 1 gün 60 dakika 3 dakika 10 dakika 25 dakika 30 dakika 20 dakika 10 dakika Çimlenme Testleri Virüslerle enfekteli olan tohum örneklerine gerçekleştirilen inaktifleştirme uygulamalarının, bazı sebze tohumlarındaki çimlenme güçlerine olan etkilerini araştırmak için bu tohumlara çimlenme testleri uygulanmıştır. Çimlenme testleri 12-15 cm petri kaplarında 25’er adet tohum kullanılarak 4 tekerrürlü olarak çift katlı kurutma kağıtları arasında yapılmıştır. Radikula 2 mm uzunluğuna ulaştığında tohumlar çimlenmiş olarak sayılmıştır ve çimlenen tohumlar ortamdan uzaklaştırılmıştır. Her gün sayım yapılmış ve 3 gün aynı değer kaydedilince deneme sonlandırılmıştır. Bu denemelerde çimlenme gücü, standart ISTA çimlenme koşulları (24-28 oC, nemli ortam ve 14 günlük gözlem) ile tespit edilmiştir. (Anderson, 1987; Duman ve Eşiyok, 1998; ISTA, 2007). İstatistik Analizler Üç tekerrürlü olarak gerçekleştirilen inaktifleştirme uygulamalarının ardından virüslerle enfekteli tohumlardaki çimlenme testleri ve çimlenme süreleri dikkate alınarak SPSS 15.0 İstatistik Programında Duncan 47 THE EFFECTS OF VARIOUS INACTIVATION TREATMENTS ON SEED GERMINATION CHARACTERISTICS IN VEGETABLE SEEDS INFECTED WITH THE VIRUSES çoklu karşılaştırma testi uygulanmış ve yapılan uygulamalar arasındaki farklar ortaya konulmuştur. (Karman, 1971; Durmuşoğlu, 2010; Knezevic et al., 2007 ). SONUÇLAR VE TARTIŞMA Viral etmenler ile enfekteli olan tohum örneklerine yapılan inaktifleştirme uygulamaları ve çimlenme testleri için değişik virüsler ile enfekteli olan 8 farklı tohum örneği seçilmiştir. Seçim sırasında tohum örneklerindeki virüsler ve bulunma durumları dikkate alınmıştır. Buna göre; inaktifleştirme çalışmaları ve çimlendirme testleri ToMV ve TMV ile enfekteli olan domates, TMV ve CMV ile enfekteli olarak belirlenen biber, CMV ile enfekteli bulunan kavun ve kabak, SMV ile enfekteli olan fasulye ve LMV enfeksiyonu belirlenen marul tohum örnekleri ile yürütülmüş ve elde edilen bulgular Çizelge 3, 4, 5, 6, 7, 8, 9 ve 10’da gösterilmiştir. ToMV ile enfekteli domates tohumlarına gerçekleştirilen inaktifleştirme çalışmaları ve çimlenme testlerinin sonuçlarına göre sıcak su uygulaması çimlenme gücünü kontrol değeri olan %99’dan %36’ya indirirken, ortalama çimlenme zamanını da 5,14 günden 7,81 güne çıkartmıştır. Sıcak su uygulaması dışındaki diğer inaktifleştirme uygulamalarının çimlenme değerleri üzerinde önemli bir etkisinin olmadığı istatistiki olarak belirlenmiştir. İnaktifleştirme uygulamalarının ardından belirlenen çimlenme gücü değerleri; HCl için %90, Ozon (60 dk. 5g/m3) için %96, Ozon (10 dk. 10 g/m3)için %96, UV için %93, Triton için %94, H2O2 için %93, Ozon (3 dk. 10g/m3) için %95, NaClO için %94, CH3COOH için %89, Etüv (80oC 24saat) için %86 ve kontrol için %99 olarak belirlenmiştir. Ortalama çimlenme zamanı değerlerinin sıcak su uygulaması dışındaki uygulamalar için 5.23 ile 6.28 gün arasında değişmekte olduğu saptanmıştır. ToMV enfekteli domates tohumlarına uygulanan inaktifleştirme çalışmalarına ve çimlenme testlerine ait bulgular Çizelge 3’de, uygulmaya ait resimler ise Şekil 1’de görülmektedir. Şekil 1. Domates tohumlarına uygulanan çimlenme testleri sonuçları, (A) ToMV ile enfekteli domates tohumlarında gerçekleştirilen çimlenme testlerine (kontrol) ait görünümü, (B) Ozon (3 dk. 10g/m3) uygulaması yapılmış olan ToMV ile enfekteli domates tohumlarında gerçekleştirilen çimlenme testlerine ait görünüm. Çizelge 3. ToMV ile enfekteli domates tohumlarına yapılan inaktifleştirme uygulamaları ve çimlenme testleri sonuçları Uygulama Çimlenme Gücü (%) HCl Sıcak Su (65 oC) Ozon (60 dk. 5g/m3) Ozon (10 dk. 10g/m3) UV Triton H2O2 Ozon (3 dk. 10g/m3) NaClO CH3COOH Etüv (80oC 24saat) Kontrol * Farklı harfler farklı istatistiki grupları ifade etmektedir ( Duncan, p ≤ 0,05). 48 90 36 96 96 93 94 93 95 94 89 86 99 c-e* f ab ab b-d a-d b-d a-c a-d de e a Ortalama Çimlenme Zamanı (gün) 5,23 a 7,81 c 5,50 ab 5,88 ab 5,61 ab 6,28 b 5,75 ab 5,75 ab 5,67 ab 5,35 ab 5,61 ab 5,14 a I. C. PAYLAN, S. ERKAN, N. ÇETINKAYA, M. ERGUN, A. CANDAR TMV ile enfekteli domates tohumlarına gerçekleştirilen inaktifleştirme ve çimlenme testleri çalışmalarından elde edilen bulgulara göre çimlenme gücü değerleri; HCl için %89, ozon (10 dk. 10 g/m3)için %92, sıcak su (65oC) için %36, ozon (60 dk. 5g/m3) için %91, ozon (3 dk. 10g/m3) için %92, CH3COOH için %86, Triton için %92, NaClO için %90, etüv (80oC 24 saat) için %86, H2O2 için %93, UV için %88 ve kontrol için %95 olarak belirlenirken, ortalama çimlenme zamanı verileri 4.93 ile 8.83 gün arasında değişmektedir. TMV enfekteli domates tohumlarına uygulanan inaktifleştirme çalışmalarına ve çimlenme testlerine ait bulgular Çizelge 4’de verilmiştir. Çizelge 4. TMV ile enfekteli domates tohumlarına yapılan inaktifleştirme uygulamarı ve çimlenme testleri sonuçları Uygulama Çimlenme Gücü (%) 89 92 36 91 92 86 92 90 86 93 88 95 HCl Ozon (10 dk. 10 g/m3) Sıcak Su (65 oC) Ozon (60 dk. 5g/m3) Ozon (3 dk. 10g/m3) CH3COOH Triton NaClO Etüv (80oC 24saat) H2O2 UV Kontrol a-c* a-c d a-c a-c c a-c a-c c ab bc a Ortalama Çimlenme Zamanı (gün) 5,34 a 5,26 a 8,83 c 5,25 a 5,36 a 5,21 a 5,41 a 4,93 a 5,43 a 5,22 a 7,05 b 4,97 a * Farklı harfler farklı istatistiki grupları ifade etmektedir ( Duncan, p ≤ 0,05). TMV ile enfekteli biber tohumlarına gerçekleştirilen inaktifleştirme ve çimlenme testleri çalışmalarından elde edilen bulgulara göre çimlenme gücü değerleri; ozon (10 dk. 10 g/m3) için %91, ozon (3 dk. 10g/m3) için %90, ozon (60 dk. 5g/m3) için %91, NaClO için %90, Triton için %86, etüv (80 O C 24saat) için %66, HCl için %80, H2O2 için %82, sıcak su (65oC) için %30, CH3COOH için %78, UV için %74 ve kontrol için %95 olarak belirlenirken, ortalama çimlenme zamanı verileri 9.13 ile 11.12 gün arasında değişmiştir (Çizelge 5). Çizelge 5. TMV ile enfekteli biber tohumlarına yapılan inaktifleştirme uygulamaları ve çimlenme testleri sonuçları Uygulama Çimlenme Gücü (%) Ozon (10 dk. 10 g/m3) Ozon (3 dk. 10g/m3) Ozon (60 dk. 5g/m3) NaClO Triton Etüv (80oC 24saat) HCl H2O2 Sıcak Su (65 oC) CH3COOH UV Kontrol 91 90 91 90 86 66 80 82 30 78 74 95 ab* ab ab ab bc f c-e cd g de e a Ortalama Çimlenme Zamanı (gün) 9,42 bc 9,85 bc 9,64 bc 9,36 bc 9,87 bc 10,01 c 10,83 d 9,78 bc 11,12 d 10,04 c 9,13 ab 8,46 a * Farklı harfler farklı istatistiki grupları ifade etmektedir ( Duncan, p ≤ 0,05). CMV ile enfekteli biber tohumlarına gerçekleştirilen inaktifleştirme ve çimlenme testleri çalışmalarından elde edilen bulgulara göre sıcak su (65oC) uygulamasının çimlenme gücünü %29’a indirdiği görülürken çimlenme 49 THE EFFECTS OF VARIOUS INACTIVATION TREATMENTS ON SEED GERMINATION CHARACTERISTICS IN VEGETABLE SEEDS INFECTED WITH THE VIRUSES değerleri diğer uygulamalar için %70 ile %92 arasında değişen oranlarda veriler oluşturmuştur. Ortalama çimlenme zamanları sıcak su (65oC) uygulaması için 12,68 gün, HCl uygulaması için 10,66 gün, Ozon (10 dk. 10 g/m3) uygulamasıiçin 9,95 gün, CH3COOH uygulaması için 10,12 gün, Ozon (60 dk. 5g/m3) uygulaması için 10,65 gün, Ozon (3 dk. 10g/m3) uygulaması için 10,37 gün, NaClO uygulaması için 9,50 gün, Triton uygulaması için 9,84 gün, Etüv (80oC 24 saat) uygulaması için 10,40 gün, UV uygulaması için 9,83 gün, H2O2 uygulaması için 10,16 gün ve kontrol için 8,81 gün olarak belirlenmiştir. Belirtilen uygulamalara ait veriler Çizelge 6’da verilmiştir. Çizelge 6. CMV ile enfekteli biber tohumlarına yapılan inaktifleştirme uygulamaları ve çimlenme testleri sonuçları Uygulama Çimlenme Gücü (%) Sıcak Su (65 oC) HCl Ozon (10 dk. 10 g/m3) CH3COOH Ozon (60 dk. 5g/m3) Ozon (3 dk. 10g/m3) NaClO Triton Etüv (80oC 24saat) UV H2O2 Kontrol 29 82 88 80 87 90 87 83 70 74 82 92 f* bc a-c cd a-c ab a-c bc e de bc a Ortalama Çimlenme Zamanı (gün) 12,68 d 10,66 c 9,95 bc 10,12 bc 10,53 c 10,37 bc 9,50 ab 9,84 bc 10,40 bc 9,83 bc 10,16 bc 8,81 a * Farklı harfler farklı istatistiki grupları ifade etmektedir ( Duncan, p ≤ 0,05). CMV ile enfekteli kavun tohumlarına gerçekleştirilen inaktifleştirme ve çimlenme testleri çalışmalarından elde edilen bulgulara göre inaktifleştirme uygulamalarının ardından çimlenme gücü değerleri; sıcak su (65oC) için %62, HCl için %99, Ozon (10 dk., 10 g/m3)için %98, Ozon (60 dk., 5g/m3) için %99, CH3COOH için %100, Ozon (3 dk., 10g/m3) için %96, Triton için %80, etüv (80oC, 24saat) için %92, H2O2 için %92, UV için %94, NaClO için %96 ve kontrol için %100 olarak belirlenirken ortalama çimlenme zamanı verileri 3,92 ile 5,58 gün arasında değişmiştir (Çizelge 7). Çizelge 7. CMV ile enfekteli kavun tohumlarına yapılan inaktifleştirme uygulamaları ve çimlenme testleri sonuçları Uygulama Çimlenme Gücü (%) Sıcak Su (65 oC) HCl Ozon (10 dk. 10 g/m3) Ozon (60 dk. 5g/m3) CH3COOH Ozon (3 dk. 10g/m3) Triton Etüv (80oC 24saat) H2O2 UV NaClO Kontrol 62 99 98 99 100 96 80 92 92 94 96 100 d* a ab a a ab c b b ab ab a Ortalama Çimlenme Zamanı (gün) 5,58 e 3,92 ab 4,08 a-c 4,09 bc 3,92 ab 4,15 c 5,01 d 3,94 ab 3,92 ab 4,17 c 3,92 ab 3,88 a * Farklı harfler farklı istatistiki grupları ifade etmektedir ( Duncan, p ≤ 0,05). CMV ile enfekteli kabak tohumlarına gerçekleştirilen inaktifleştirme uygulamalarının ardından çimlenme gücü değerleri; HCl için %82, sıcak su (65oC) için %24, Triton için %69, Ozon (10 dk., 10 g/m3) için %89, Ozon (3 dk., 10g/m3) için %89, UV için %83, NaClO için %80, Ozon (60 dk., 5g/m3) için %89, H2O2 için %88, 50 I. C. PAYLAN, S. ERKAN, N. ÇETINKAYA, M. ERGUN, A. CANDAR CH3COOH için %86 ve kontrol için %90 olarak belirlenirken ortalama çimlenme zamanı verilerinin 3,91 ile 5,36 gün arasında değişmekte olduğu yapılan denemeler sonucunda belirlenmiştir. CMV enfekteli kabak tohumlarına uygulanan inaktifleştirme çalışmalarına ve çimlenme testlerine ait bulgular Çizelge 8’de verilmiştir. Çizelge 8. CMV ile enfekteli kabak tohumlarına yapılan inaktifleştirme uygulamaları ve çimlenme testleri sonuçları Uygulama Çimlenme Gücü (%) Ortalama Çimlenme Zamanı (gün) 3,91 a HCl 82 bc* Sıcak Su (65 oC) 24 e 5,36 d Triton 69 d 4,81 c Ozon (10 dk. 10 g/m3) 89 ab 4,26 b Ozon (3 dk. 10g/m3) 89 ab 4,38 b UV 83 a-c 4,30 b Etüv (80oC 24saat) 80 c 4,07 ab NaClO 80 c 4,29 b Ozon (60 dk. 5g/m3) 89 ab 4,31 b H2O2 88 ab 4,32 b CH3COOH 86 a-c 3,92 a Kontrol 90 a 3,90 a * Farklı harfler farklı istatistiki grupları ifade etmektedir ( Duncan, p ≤ 0,05). SMV ile enfekteli fasulye tohumlarına gerçekleştirilen inaktifleştirme uygulamalarının ardından çimlenme gücü değerleri; HCl için %66, Ozon (60 dk. 5g/m3) için %83, Ozon (10 dk., 10 g/m3) için %83, etüv (80oC 24saat) için %69, Ozon (3 dk., 10g/m3) için %86, sıcak su (65oC) için %33, Triton için %73, UV için %68, NaClO için %81, H2O2 için %72, CH3COOH için %59 ve kontrol için %86 olarak belirlenirken, ortalama çimlenme zamanı verileri 7,50 ile 8,82 gün arasında değişmiştir (Çizelge 9). Çizelge 9. SMV ile enfekteli fasulye tohumlarına yapılan inaktifleştirme uygulamaları ve çimlenme testleri sonuçları Uygulama Çimlenme Gücü (%) HCl Ozon (60 dk. 5g/m3) Ozon (10 dk. 10 g/m3) Etüv (80oC 24saat) Ozon (3 dk. 10g/m3) Sıcak Su (65 oC) Triton UV NaClO H2O2 CH3COOH Kontrol 66 83 83 69 86 33 73 68 81 72 59 86 bc* a a b a d b b a b c a Ortalama Çimlenme Zamanı (gün) 8,17 c-e 7,69 a-c 8,07 cd 7,95 b-d 8,06 cd 8,82 f 8,38 d-f 8,58 ef 7,50 ab 8,28 de 8,06 cd 7,22 a * Farklı harfler farklı istatistiki grupları ifade etmektedir ( Duncan, p ≤ 0,05). LMV ile enfekteli olan marul tohumlarına gerçekleştirilen inaktifleştirme çalışmaları ardından yapılan çimlenme testleri sonucunda sıcak su uygulamalarının marul tohumlarındaki çimlenme gücünü %0’a indirdiği saptanmıştır. Diğer uygulamaların çimlenme gücü değerleri; Triton için %89.5, CH3COOH için %84, Ozon (10 dk. 10 g/m3) için %89.5, Ozon (3 dk., 10g/m3) için %91, Ozon (60 dk., 5g/m3) için %90, H2O2 için %84, Etüv (80oC 24 51 THE EFFECTS OF VARIOUS INACTIVATION TREATMENTS ON SEED GERMINATION CHARACTERISTICS IN VEGETABLE SEEDS INFECTED WITH THE VIRUSES saat) için %80, HCl için %84.5, UV için %85, NaClO için %90 ve kontrol için %92.5 olarak belirlenirken ortalama çimlenme zamanı verileri 4,08 ile 4,78 gün arasında değişmektedir (Çizelge 10). Çizelge 10. LMV ile enfekteli marul tohumlarına yapılan inaktifleştirme uygulamaları ve çimlenme testleri sonuçları Uygulama Çimlenme Gücü (%) 89,5 84,0 89,5 91,0 90,0 0,0 84,0 80,0 84,5 85,0 90,0 92,5 Triton CH3COOH Ozon (10 dk. 10 g/m3) Ozon (3 dk. 10g/m3) Ozon (60 dk. 5g/m3) Sıcak Su (65 oC) H2O2 Etüv (80oC 24saat) HCl UV NaClO Kontrol a* b a a a d b c b b a a Ortalama Çimlenme Zamanı (gün) 4,53 de 4,08 ab 4,33 b-d 4,24 a-d 4,53 de 0,00 --4,41 cd 4,78 e 4,11 ab 4,14 a-c 4,44 d 4,03 a * Farklı harfler farklı istatistiki grupları ifade etmektedir ( Duncan, p ≤ 0,05). Sonuç olarak, inaktifleştirme uygulamalarının genel olarak çimlenme güçleri üzerine olan etkisine baktığımız zaman, sıcak su uygulaması dışındaki uygulamaların çoğunlukla kontrol değerlerine yakın değerlerde olduğu görülmüş ve önemli derecede olumsuz etkilerinin olmadığı kanısına varılmıştır. Sıcak su (65oC) uygulamalarının ise hemen hemen tüm bitki türleri ve virüslerle yapılan çalışmalarda çimlenme değerleri üzerinde olumsuz etkileri olmuştur. Sıcak su uygulamaları çimlenme gücünü ortalama %94’ten %31 gibi düşük rakamlara indirmiştir (Şekil 2). Daha önce yürütülen çalışmalarda da benzer sonuçlar elde edilmiştir, Değirmenci vd. (2009) 50oC ve 65oC’lik termoterapi uygulamalarının mısır tohumlarında Maize dwarf mosaic potyvirus (MDMV) etmeninin konsantrasyonunu azalttığını, ancak çimlenme zamanı üzerinde olumsuz etkileri olduğunu belirtmişlerdir. Şekil 2. İnaktifleştirme uygulamalarının çimlenme güçleri üzerine ortalama % etkileri Bu veriler ışığında gerek viral konsantrasyon üzerine etkileri, gerekse çimlenme özellikleri üzerine herhangi bir olumsuz etkileri olmaması nedeniyle, HCl ve ozon uygulamaları viral etmenleri elimine etme amacıyla gerçekleştirilen inaktifleştirme uygulamaları için en etkili ve umutvar uygulamalar olarak göze çarpmaktadır. Benzer şekilde diğer bir araştırmada da, HCl uygulamalarının diğer uygulamalara göre daha etkili olduğu ve çimlenme üzerine herhangi bir olumsuz etkisinin olmadığı belirtilirken, sıcak su ve CH3COOH uygulamalarının çimlenme üzerine olumsuz etki ettikleri vurgulanmıştır (Koyuncu, 1993). CGMMV ile yapılan bir çalışmada 75 52 I. C. PAYLAN, S. ERKAN, N. ÇETINKAYA, M. ERGUN, A. CANDAR dakika süre ile 6 g/saat ozon uygulanması ve ToMV ile yapılan başka bir çalışmada ise 20 gr/saat ozonun 60 dakika muamelesi sonucunda etmenlerin tamamen eradike olduğu belirlenmiştir (Runia, 1995). Ozon bitkilerde gösterdiği benzer etkileri mikrobiyal yapılarda da göstermektedir. Fungal patojenleri toprak veya hava kaynaklı olmalarına bakmaksızın öldürdüğü (Yamamoto et al., 1990), bakteriyel membranları etkilediği, enzim yapılarını ve nükleik asit metabolizmasını bozduğu önceki çalışmalarda belirtilmiştir. Viral etmenlerde ise, modifiye olmasına neden olduğu veya proteininin parçalanabildiği ifade edilmektedir (EPA, 1999). Bitkilere ozon uygulaması ile virüs konsantrasyonlarıazalmakla birlikte sinyal iletişim mekanizmaları harekete geçirilerek hastalıklara dayanıklılık sağlayan faktörlerin uyarılabildiği de belirtilmektedir (Sandermann, 1996; Schubert et al., 1997). Tüm bu veriler dikkate alınarak, farklı doz ve sürelerde yapılacak yeni çalışmalar ile HCl ve ozon uygulamalarının viral konsantrasyonu azaltma konusundaki başarısının daha da artabileceği düşünülmektedir. VİRAL ETMENLER İLE ENFEKTELİ SEBZE TOHUMLARINA YAPILAN DEĞİŞİK İNAKTİFLEŞTİRME UYGULAMALARININ ÇİMLENME ÖZELLİKLERİ ÜZERİNE ETKİLERİ ÖZET Ülkemizde tohumluk üretimi açısından önemli olan domates, biber, kavun, kabak, fasulye ve marul tohumlarına uygulanan virüs inaktifleştirme yöntemlerinin tohumların çimlenme özellikleri üzerine etkilerinin araştırılması bu çalışmanın içeriğini oluşturmaktadır. Araştırma için Tomato mosaic virus (ToMV), Tobacco mosaic virus (TMV), Cucumber mosaic virus (CMV), Soybean mosaic virus (SMV) ve Lettuce mosaic virus (LMV) ile enfekteli 8 tohum örneğine kimyasal, kuru sıcaklık, ozon, sıcak su ve UV gibi virüs inaktifleştirme uygulamaları yapılmıştır. Bahsedilen uygulamalar sonucunda tohum örneklerine çimlendirme testleri uygulanmış ve sonuçlar istatistikî olarak değerlendirilmiştir. Değerlendirme için tohumların çimlenme gücü (%) ve ortalama çimlenme süresi (gün) dikkate alınmıştır. Buna göre, HCl ve ozon uygulaması dışındaki uygulamalar çimlenme gücünü oldukça düşürmüştür. Öte yandan, HCl ve ozon uygulamalarında çimlenme gücü kontrole yakın bulunmuştur. Çimlenme gücünü en çok etkileyen yöntem ise sıcak su (65 °C) uygulaması olmuştur. Sıcak su uygulamaları çimlenme gücünü ortalama %94’ten %31 gibi düşük rakamlara indirmiştir.Sonuç olarak, HCl ve ozon uygulamaları viral etmenleri elimine etmedeki başarısının yanısıra çimlenme değerleri üzerine olumsuz etkileri olmaması nedeniyle, en etkili yöntemler olarak saptanmıştır. Bu veriler ışığında, HCl ve ozon uygulamalarının farklı doz ve sürelerde tohumlardaki viral konsantrasyonu azaltma konusundaki etkisinin daha da artabileceği düşünülmektedir. Anahtar Sözcükler: Sebze, tohum, virüs, virüs inaktifleştirme uygulamaları, çimlenme özellikleri KAYNAKLAR Açıkgöz, N., H. Saygılı, B. Eser ve F. Savran, 1997. Türkiye’de tohumculuk ve tohumculuk politikaları. E.Ü.Tarımsal Uygulama ve Araştırma Merkezi, Yayım no; 32 İzmir. Anderson, L., 1987. Survey and control of seed borne diseases of tomatoes in Zambia. Sveriges Landbrukuniversitet Arbetsrapport 56, Working Paper Uppsala, 27p. Antıgnus, Y., 1999. Diagnosis and control of vegetable seed-borne viruses. Detection of virus Diseasesby Advanced Techniques and Control. Proceedings of the 1th Israeli-Turkish Workshop, 22-29 August, 1999, Adana Turkey. Bwye, A.M., R.A.C. Jones, and W. Proudlove, 1994. Effects of sowing seed with different levels of infection, plant density and the growth stage at which plants first develop symptoms on cucumber mosaic virus infection of narrow-leafed lupins (Lupinus angustifolius). Australian Journal of Agricultural Research 45: 1395-1412. Değirmenci K., B. Akbaş, ve R Cengiz., 2009. Bazı mısır hatlarına ait tohumlarda Maize dwarf mosaic virus (MDMV)’nün varlığının belirlenmesi ve termopterapi uygulaması ile tohumlardan arındırılması. Türkiye III. Bitki Koruma Kongresi Bildirileri, pp. 203. 53 THE EFFECTS OF VARIOUS INACTIVATION TREATMENTS ON SEED GERMINATION CHARACTERISTICS IN VEGETABLE SEEDS INFECTED WITH THE VIRUSES Duman, İ. ve D. Eşiyok, 1998. Ekim Öncesi PEG ve KH2PO4 uygulamalarının havuç tohumlarının çimlenme ve çıkış oranı ile verim üzerine etkileri, Tübitak, J. of Agriculture and Forestry, 22: 445–449. Durmuşoğlu, E.,2010. Entomolojide Deneme Tekniği. Ege Üniversitesi Ziraat Fakültesi Bitki Koruma Bölümü, 54s, Basılmamış Lisansüstü Ders Notu. EPA,1999. Unites States Environmental Protection Agency. Alternative disinfectants and oxidents guidance manual of ice of water. EPA 815-R-99-014, April, 1999. http://www.epa.gov/safewater/mdbp/alternative_ disinfectanrs_guidance.pdf Erkan, S.,1983. Vergleichende untersuchungen über die anwendungmöglichkeiten von milch und Capsicum pressaft zum schultz von tomatenpflanzen gegen tomaten mosaik. J. Turkish Phytopath. 12 (1):27-31. Erkan, S.,1998, Tohum Patolojisi. E. Ü. Ziraat Fakültesi Bitki Koruma Bölümü, Bornova, İzmir. Gözdem Ofis, 275 s. Goodıng, G.V.J.R.,and E.G. Suggs, 1976. Seedborne tobacco mosaic virus in commercial sources of tomato seed. Pl. Dis. Rep.60:441-442. ISTA, 2007. http://www.seedtest.org/en/home.html (Erişim Tarihi: 2007) John, C.A.,and C. Sova, 1955. Incidence of Tobacco Mosaic virus on tomato seed. Phytopathology 45: 636-637. Karman, M.,1971. Bitki Koruma Araştırmalarında Genel Bilgiler Denemelerin Kuruluşu ve Değerlendirme Esasları, Bölge Zirai Araştırma Enstitüsü, İzmir, Bornova, 280s. Khetarpal, R.K.,and Y. Maury, 1987. Pea seed-borne mosaic: a review. Agronomie 7: 215-224. Knezevıc, S.Z., J.C. Streıbıg, andJ.Rıtz, 2007. Utilizing R Software Package for dose–response studies: the concept and data analysis. Weed Technology 21: 840–848. Koyuncu, H.,1993. Domates (Lycopersicon esculentum L. ) Tohumlarındaki Viral Etmenlerin Tanılanması ve İnaktifleştirilmesi Üzerinde Araştırmalar. Yüksek Lisans Tezi. 86s. Ege Üniv. Fen Bilimleri Ens. Bitki Koruma ABD. Bornova-İzmir. Makkouk, K.M.,and S.G. Kumarı, 1990. Variability among 19 lentil genotypes in seed transmission rates and yield loss induced by broad bean stain virus infection. LENS Newsletter 17: 31-32. Rıchardson, M.J.,1990. An annotated list of seed borne diseases. The International Seed Testing Assosciation Zurich, Switzerland. Runia, W.T.,1994. Disinfection of recirculation water from closed cultivation systems with ozone. Acta Horticulture 36:388-396. Sandermann, H.,1996. Ozone and plant health.Annual Review of Phytopathology, 34:347-366. Schubert, R., R. Fischer, R. Hain, P.H. Schreer, G. Bahnweg, D.Ernst, and H.Sandermann, 1997. An ozoneresponsive region of grapevine resveratrol synthase promoter differs from the basal pathogen-responsive sequence. Plant Molecular Biology 34:417-426. Shukla, D.D., C.W. Ward, and A.A. Brunt, 1994. The Potyviridae. CAB International, Wallingford, UK. Taylor, R.H., R.G. Grogan, and K.A. Kımble, 1961. Transmission of Tobacco mosaic virus in tomato seed. Phytopathology 51:837-842. Tu, J.C., 1989. Effect of different strains of soybean mosaic virus on growth, maturity, yield, seed mottling and seed transmissionin several soybean cultivars. Journal of Phytopathology 126: 231-236. Walkey, D.G.A., 1991. Applied Plant Virology. Great Britain by St Edmundsbury Press, 338 p. Yamamoto, H., Treada, T., Naganawa, T. and Tatsuyama, K.,1990.Disinfectious effect ozonation on water infested with several Rppt-infecting pathogens.Ann. Phytopath. Soc. Jpn. 56: 250-251. Yorgancı, Ü., S. Erkan, H. Özaktan, ve B. Eser, 1993. Biber, domates, patlican ve hiyar tohumlarinda viral ve bakteriyel hastalik etmenlerinin tanilanmasi ve inaktifleştirilmesi üzerinde araştirmalar. TUBİTAK, Proje No: TOAG-822. 54